CRISPR

CRISPR1-kat2b

ID
ZDB-CRISPR-180613-5
Name
CRISPR1-kat2b
Previous Names
None
Target
Sequence
5' - CAGTTCTGTGACAGTCTCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
co1008 kat2b
Expression
Gene expression in Wild Types + CRISPR1-kat2b
Expressed Gene Anatomy Figures
bmp4 Fig. 6,  Fig. 8 from Ghosh et al., 2017
fgf10a Fig. 8 from Ghosh et al., 2017
hey2 Fig. 8 from Ghosh et al., 2017
myl7 Fig. 5 from Ghosh et al., 2017
nppa Fig. 8 from Ghosh et al., 2017
tbx2b Fig. 8 from Ghosh et al., 2017
Phenotype
Phenotype resulting from CRISPR1-kat2b
Phenotype Fish Figures
atrium morphology, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
atrium size, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
cardiac ventricle morphology, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
cardiac ventricle size, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
heart morphology, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
heart contraction decreased rate, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
heart looping process quality, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
heart tube nppa expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
heart tube bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
heart tube nppa expression decreased distribution, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
heart tube nppa expression spatial pattern, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
paired fin absent, abnormal WT + CRISPR1-kat2b Fig. 6 from Ghosh et al., 2017
paired fin fgf10a expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
paired fin bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal WT + CRISPR1-kat2b Fig. 6 from Ghosh et al., 2017
paired fin morphology, abnormal WT + CRISPR1-kat2b Fig. 6 from Ghosh et al., 2017
pericardium edematous, abnormal WT + CRISPR1-kat2b Fig. 5 from Ghosh et al., 2017
whole organism tbx2b expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
whole organism nppa expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
whole organism hey2 expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
whole organism bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
whole organism fgf10a expression decreased amount, abnormal WT + CRISPR1-kat2b Fig. 8 from Ghosh et al., 2017
Phenotype of all Fish created by or utilizing CRISPR1-kat2b
Phenotype Fish Conditions Figures
ethmoid cartilage decreased size, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ceratobranchial cartilage decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ethmoid cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
ceratohyal cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
Meckel's cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
ceratobranchial cartilage decreased size, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ceratobranchial 5 cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
ceratohyal cartilage col2a1a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
neurocranium col2a1a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
ceratobranchial 3 cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
hyosymplectic cartilage decreased size, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ceratobranchial 1 cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
whole organism ab24-h3 labeling decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 5 with image from Sen et al., 2018
maxilla runx2a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 4 with image from Sen et al., 2018
cleithrum runx2a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 4 with image from Sen et al., 2018
branchiostegal ray runx2a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 4 with image from Sen et al., 2018
pterygoid process decreased size, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
opercle runx2a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 4 with image from Sen et al., 2018
Meckel's cartilage decreased length, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
whole organism dead, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
pharyngeal arch 3-7 sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
neurocranial trabecula deformed, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ceratobranchial 4 cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
palatoquadrate cartilage decreased size, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
Meckel's cartilage col2a1a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
dentary runx2a expression increased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 4 with image from Sen et al., 2018
ceratobranchial cartilage col2a1a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
ceratobranchial 2 cartilage sox9a expression decreased amount, abnormal kat2bco1008/co1008 (AB) standard conditions Fig. 3 with image from Sen et al., 2018
heart tube nppa expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
whole organism nppa expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
heart contraction decreased rate, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
paired fin absent, abnormal WT + CRISPR1-kat2b standard conditions Fig. 6 from Ghosh et al., 2017
paired fin bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 6 from Ghosh et al., 2017
cardiac ventricle size, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
whole organism bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
heart looping process quality, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
heart tube nppa expression decreased distribution, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
paired fin fgf10a expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
whole organism hey2 expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
whole organism fgf10a expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
pericardium edematous, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
heart tube bmp4 expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
atrium morphology, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
heart tube nppa expression spatial pattern, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
paired fin morphology, abnormal WT + CRISPR1-kat2b standard conditions Fig. 6 from Ghosh et al., 2017
paired fin decreased size, abnormal WT + CRISPR1-kat2b standard conditions Fig. 6 from Ghosh et al., 2017
atrium size, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
heart morphology, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
whole organism tbx2b expression decreased amount, abnormal WT + CRISPR1-kat2b standard conditions Fig. 8 from Ghosh et al., 2017
cardiac ventricle morphology, abnormal WT + CRISPR1-kat2b standard conditions Fig. 5 from Ghosh et al., 2017
pharyngeal arch neural crest cell decreased amount, abnormal kat2bco1008/co1008; zf566Tg standard conditions Fig. 5 with image from Sen et al., 2018
pharyngeal arch neural crest cell disorganized, abnormal kat2bco1008/co1008; zf566Tg standard conditions Fig. 5 with image from Sen et al., 2018
pharyngeal arch 3-7 ab24-h3 labeling decreased amount, abnormal kat2bco1008/co1008; zf566Tg standard conditions Fig. 5 with image from Sen et al., 2018
pharyngeal arch 3-7 GFP expression decreased amount, abnormal kat2bco1008/co1008; zf566Tg standard conditions Fig. 5 with image from Sen et al., 2018
ceratobranchial cartilage decreased amount, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ethmoid cartilage decreased size, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
ceratobranchial cartilage decreased size, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
hyosymplectic cartilage decreased size, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
Meckel's cartilage decreased length, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
pterygoid process decreased size, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
neurocranial trabecula deformed, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
palatoquadrate cartilage decreased size, abnormal kat2aco1007/co1007; kat2bco1008/co1008 (AB) standard conditions Fig. 2 with image from Sen et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.