CRISPR

CRISPR1-wwtr1

ID

ZDB-CRISPR-180608-1

Name

CRISPR1-wwtr1

Previous Names

None

Target

wwtr1 (1)

Sequence

5' - TCACCACATGGCACGACCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bns35	wwtr1

Expression

Gene expression in Wild Types + CRISPR1-wwtr1

No data available

Phenotype

Phenotype resulting from CRISPR1-wwtr1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-wwtr1

Phenotype	Fish	Conditions	Figures
notochord wwtr1 expression absent, abnormal	wwtr1^bns35/bns35	control	Fig. 2-S2 from Kimelman et al., 2017
ectoderm wwtr1 expression absent, abnormal	wwtr1^bns35/bns35	control	Fig. 2-S2 from Kimelman et al., 2017
cardiac ventricle trabecula formation decreased process quality, abnormal	wwtr1^bns35/bns35; s883Tg	standard conditions	Fig. 2 from Lai et al., 2018
trabecular layer of ventricle lacks parts or has fewer parts of type cardiac muscle cell, abnormal	wwtr1^bns35/bns35; s883Tg	standard conditions	Fig. 2 from Lai et al., 2018
ventricular trabecula myocardium morphogenesis decreased process quality, abnormal	wwtr1^bns35/bns35; s883Tg	standard conditions	Fig. 2 from Lai et al., 2018
trabecular layer of ventricle malformed, abnormal	wwtr1^bns35/bns35; s883Tg	standard conditions	Fig. 2 from Lai et al., 2018
compact layer of ventricle cortical actin cytoskeleton GFP expression spatial pattern, abnormal	wwtr1^bns35/bns35; s974Tg	standard conditions	Fig. 5 from Lai et al., 2018
compact layer of ventricle cortical actin cytoskeleton malformed, abnormal	wwtr1^bns35/bns35; s974Tg	standard conditions	Fig. 5 from Lai et al., 2018
compact layer of ventricle cell junction oblique orientation, abnormal	wwtr1^bns35/bns35; sd11Tg; zf517Tg	standard conditions	Fig. 5 from Lai et al., 2018
compact layer of ventricle cell junction oblique orientation, abnormal	wwtr1^bns35/bns35; zf517Tg	standard conditions	Fig. 5 from Lai et al., 2018
dorsal aorta mrc1a expression mislocalised, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	control	Fig. 5 from Astone et al., 2018
caudal fin curved, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	standard conditions	Fig. 5 from Astone et al., 2018
notochord undulate, abnormal	yap1^bns19/bns19; wwtr1^bns35/+	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein split, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein spatial deviation, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
posterior caudal vein morphology, abnormal	yap1^bns19/bns19; wwtr1^bns35/+; ci1Tg; nz101Tg	standard conditions	Fig. 5 from Astone et al., 2018
epidermis morphogenesis process quality, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 6 from Kimelman et al., 2017
ectoderm separated from somite, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 11 from Kimelman et al., 2017
ectoderm anatomical region ab2-fn labeling spatial pattern, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 9 from Kimelman et al., 2017
ventral fin fold epidermal cell increased speed, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 8 from Kimelman et al., 2017
notochord posterior region ab2-fn labeling decreased amount, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 9 from Kimelman et al., 2017
pericardium edematous, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
ectoderm decreased thickness, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 5 , Fig. 6 from Kimelman et al., 2017
whole organism posterior region morphology, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
somite shape, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Kimelman et al., 2017
ectoderm ecrg4b expression absent, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 3 from Kimelman et al., 2017
notochord undulate, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 1 , Fig. 9 from Kimelman et al., 2017
notochord posterior region wu:fc23c09 expression absent, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 3-S1 from Kimelman et al., 2017
ventral fin fold epidermis morphogenesis process quality, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 7 from Kimelman et al., 2017
ventral fin fold epidermal cell shape, abnormal	yap1^bns19/bns19; wwtr1^bns35/bns35	control	Fig. 8 from Kimelman et al., 2017
epidermal basal stratum chromosome damaged, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 4 from Lai et al., 2022
ectoderm ab1-tp63 labeling decreased amount, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 1 from Lai et al., 2022
epidermal basal stratum cell apoptotic, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 1 , Fig. 4 from Lai et al., 2022
epidermal basal stratum cell decreased size, abnormal	yap1^bns22/bns22; wwtr1^bns35/bns35	standard conditions	Fig. 5 from Lai et al., 2022

Citations