CRISPR

CRISPR1-gja8b

ID
ZDB-CRISPR-180213-345
Name
CRISPR1-gja8b
Previous Names
None
Target
Sequence
5' - GGGAAGCGTCCGTACGGCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zko933a gja8b
Expression
Gene expression in Wild Types + CRISPR1-gja8b
No data available
Phenotype
Phenotype resulting from CRISPR1-gja8b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gja8b
Phenotype Fish Conditions Figures
lens fiber cell autophagosome decreased amount, abnormal gja8bzko933a/zko933a standard conditions Fig. 3 with image from Ping et al., 2021
lens fiber cell endoplasmic reticulum disassembly process quality, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens Ab14-hspa5 labeling increased amount, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens central region has extra parts of type lens fiber cell cytoskeleton, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens fiber cell differentiation decreased process quality, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with image from Ping et al., 2021
lens zl-1 labeling increased amount, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with image from Ping et al., 2021
lens fiber cell organelle disassembly process quality, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens opaque, abnormal gja8bzko933a/zko933a standard conditions Fig. 1 with image from Ping et al., 2021
lens fiber cell autophagy decreased process quality, abnormal gja8bzko933a/zko933a standard conditions Fig. 3 with image from Ping et al., 2021
lens Ab14-hspa5 labeling increased amount, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens ab1-mip labeling increased amount, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens development in camera-type eye process quality, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens Ab14-hspa5 labeling amount, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with imageFig. 8 with image from Ping et al., 2021
lens ab1-mip labeling increased amount, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens ab1-mip labeling amount, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with imageFig. 8 with image from Ping et al., 2021
lens development in camera-type eye decreased process quality, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens central region has extra parts of type lens fiber cell nucleus, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens opaque, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens central region has number of lens fiber cell nucleus, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens fiber cell organelle disassembly decreased process quality, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens fiber cell autophagosome amount, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 6 with image from Ping et al., 2021
lens central region has extra parts of type lens fiber cell nucleus, abnormal gja8bzko933a/zko933a chemical treatment by environment: 3-methyladenine, chemical treatment by environment: sirolimus Fig. 8 with image from Ping et al., 2021
lens development in camera-type eye decreased process quality, abnormal gja8bzko933a/zko933a control Fig. 7 with image from Ping et al., 2021
lens central region has number of lens fiber cell endoplasmic reticulum, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens fiber cell endoplasmic reticulum disassembly decreased process quality, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens central region has number of lens fiber cell cytoskeleton, ameliorated gja8bzko933a/zko933a chemical treatment by environment: sirolimus Fig. 7 with image from Ping et al., 2021
lens central region has extra parts of type lens fiber cell endoplasmic reticulum, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
lens central region has extra parts of type lens fiber cell cytoskeleton, abnormal gja8bzko933a/zko933a standard conditions Fig. 2 with imageFig. 7 with image from Ping et al., 2021
Citations