CRISPR

CRISPR1-tubgcp3

ID
ZDB-CRISPR-180213-328
Name
CRISPR1-tubgcp3
Previous Names
None
Target
Sequence
5' - GGTCCTCACAGAGGCTGAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3126 tubgcp3
zko902a tubgcp3
zko902b tubgcp3
Expression
Gene expression in Wild Types + CRISPR1-tubgcp3
No data available
Phenotype
Phenotype resulting from CRISPR1-tubgcp3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tubgcp3
Phenotype Fish Conditions Figures
ciliary marginal zone cdkn1ca expression decreased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 4 with image from Li et al., 2019
brain decreased size, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
ciliary marginal zone vsx2 expression decreased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 4 with image from Li et al., 2019
ciliary marginal zone spindle assembly disrupted, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 5 with image from Li et al., 2019
swim bladder uninflated, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
ciliary marginal zone cell death increased process quality, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 6 with image from Li et al., 2019
ciliary marginal zone ab4-h3 labeling increased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 5 with imageFIGURE 6 with image from Li et al., 2019
ciliary marginal zone ccnd1 expression decreased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 4 with image from Li et al., 2019
whole organism tubgcp3 expression decreased amount, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
ciliary marginal zone ab7-h2afx labeling increased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 6 with image from Li et al., 2019
eye decreased size, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
cell division decreased process quality, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 6 with image from Li et al., 2019
ciliary marginal zone disorganized, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 3 with image from Li et al., 2019
ciliary marginal zone atoh7 expression decreased distribution, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 4 with image from Li et al., 2019
ciliary marginal zone cell cycle arrested, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 5 with image from Li et al., 2019
retina centriole disorganized, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 5 with image from Li et al., 2019
axis decreased length, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
caudal fin curved, abnormal tubgcp3zf3126/zf3126 standard conditions FIGURE 2 with image from Li et al., 2019
head EGFP expression decreased distribution, abnormal tubgcp3zf3126/zf3126; knu3Tg standard conditions FIGURE 2 with image from Li et al., 2019
Citations