CRISPR

CRISPR1-atrn

ID

ZDB-CRISPR-171122-2

Name

CRISPR1-atrn

Previous Names

None

Target

atrn (1)

Sequence

5' - GGCTACCTCTCTGATGGACCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
tsu22	atrn
tsu23	atrn

Expression

Gene expression in Wild Types + CRISPR1-atrn

No data available

Phenotype

Phenotype resulting from CRISPR1-atrn

No data available

Phenotype of all Fish created by or utilizing CRISPR1-atrn

Phenotype	Fish	Conditions	Figures
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 7 from Sun et al., 2017
EVL shape, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 8 from Sun et al., 2017
external yolk syncytial layer marginal blastomere shape, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 8 from Sun et al., 2017
external yolk syncytial layer actomyosin structure organization decreased occurrence, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 8 from Sun et al., 2017
external yolk syncytial layer actomyosin decreased width, abnormal	atrn^tsu22/tsu22	standard conditions	Fig. 8 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 7 from Sun et al., 2017
external yolk syncytial layer marginal blastomere shape, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 8 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 7 from Sun et al., 2017
EVL shape, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 8 from Sun et al., 2017
external yolk syncytial layer actomyosin structure organization decreased occurrence, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 8 from Sun et al., 2017
external yolk syncytial layer actomyosin decreased width, abnormal	atrn^tsu23/tsu23	standard conditions	Fig. 8 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu22/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu22/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu22/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu23/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu23/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu23/+	standard conditions	Fig. 7 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second delayed, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second increased duration, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer marginal blastomere shape, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer actomyosin structure organization decreased occurrence, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017
external yolk syncytial layer actomyosin decreased width, abnormal	atrn^tsu22/tsu22; alkbh4^tsu20/tsu20	standard conditions	Fig. 9 from Sun et al., 2017

Citations