CRISPR

CRISPR2-lepr

ID

ZDB-CRISPR-160816-3

Name

CRISPR2-lepr

Previous Names

None

Target

lepr (1)

Sequence

5' - GGAGCGCCAGTAAAGCCGTGTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nz303	lepr

Expression

Gene expression in Wild Types + CRISPR2-lepr

No data available

Phenotype

Phenotype resulting from CRISPR2-lepr

Phenotype	Fish	Figures
pancreas has extra parts of type pancreatic B cell, abnormal	vu513Tg + CRISPR2-lepr	Fig. 3 from Michel et al., 2016

Phenotype of all Fish created by or utilizing CRISPR2-lepr

Phenotype	Fish	Conditions	Figures
glucose homeostasis decreased process quality, abnormal	lepr^nz303/nz303 (AB)	nutrient increased	Fig. 2 from Kamstra et al., 2022
whole organism increased length, abnormal	lepr^nz303/nz303 (AB)	nutrient increased	Fig. 2 from Kamstra et al., 2022
glucose homeostasis decreased process quality, abnormal	lepr^nz303/nz303 (AB)	chemical treatment by injection: Leptin	Fig. 4 from Kamstra et al., 2022
whole organism increased mass, abnormal	lepr^nz303/nz303 (AB)	nutrient increased	Fig. 2 from Kamstra et al., 2022
blood glucose increased amount, abnormal	lepr^nz303/nz303 (AB)	chemical treatment by injection: Leptin, chemical treatment by environment: glucose	Fig. 1 from Kamstra et al., 2022
glucose homeostasis process quality, ameliorated	lepr^nz303/nz303 (AB)	chemical treatment by environment: lithium chloride	Fig. 4 from Kamstra et al., 2022
glucose homeostasis process quality, ameliorated	lepr^nz303/nz303 (AB)	chemical treatment by injection: Leptin, chemical treatment by environment: lithium chloride	Fig. 4 from Kamstra et al., 2022
blood glucose increased amount, abnormal	lepr^nz303/nz303 (AB)	nutrient increased	Fig. 2 from Kamstra et al., 2022
blood glucose increased amount, abnormal	lepr^nz303/nz303 (AB)	chemical treatment by environment: glucose	Fig. 1 from Kamstra et al., 2022
glucose homeostasis decreased process quality, abnormal	lepr^nz303/nz303 (AB)	control	Fig. 2 , Fig. 4 from Kamstra et al., 2022
glucose homeostasis decreased process quality, abnormal	lepr^nz303/nz303 (AB)	chemical treatment by environment: glucose	Fig. 1 from Kamstra et al., 2022
glucose homeostasis decreased process quality, abnormal	lepr^nz303/nz303 (AB)	chemical treatment by injection: Leptin, chemical treatment by environment: glucose	Fig. 1 from Kamstra et al., 2022
hypothalamus mCherry expression amount, ameliorated	ia5Tg + CRISPR2-lepr	chemical treatment by injection: Leptin	Fig. 3 from Kamstra et al., 2022
heart mCherry expression increased amount, abnormal	ia5Tg + CRISPR2-lepr	chemical treatment by environment: lithium chloride	Fig. 3 from Kamstra et al., 2022
hypothalamus mCherry expression increased amount, abnormal	ia5Tg + CRISPR2-lepr	chemical treatment by environment: lithium chloride	Fig. 3 from Kamstra et al., 2022
heart canonical Wnt signaling pathway increased process quality, abnormal	ia5Tg + CRISPR2-lepr	chemical treatment by environment: lithium chloride	Fig. 3 from Kamstra et al., 2022
hypothalamus canonical Wnt signaling pathway increased process quality, abnormal	ia5Tg + CRISPR2-lepr	chemical treatment by environment: lithium chloride	Fig. 3 from Kamstra et al., 2022
hypothalamus canonical Wnt signaling pathway process quality, ameliorated	ia5Tg + CRISPR2-lepr	chemical treatment by injection: Leptin	Fig. 3 from Kamstra et al., 2022
pancreas has extra parts of type pancreatic B cell, abnormal	vu513Tg + CRISPR2-lepr	standard conditions	Fig. 3 from Michel et al., 2016

Citations