CRISPR

CRISPR1-sirt7

ID
ZDB-CRISPR-160525-16
Name
CRISPR1-sirt7
Previous Names
None
Target
Sequence
5' - TCGTCGGCTCAGCTCCTGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihblqs4 sirt7
ihblqs7 sirt7
Expression
Gene expression in Wild Types + CRISPR1-sirt7
No data available
Phenotype
Phenotype resulting from CRISPR1-sirt7
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sirt7
Phenotype Fish Conditions Figures
whole organism vegfaa expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism serpine1 expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
response to hypoxia increased magnitude, ameliorated sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism epoa expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism egln3 expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism cited2 expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
nucleate erythrocyte increased amount, exacerbated sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism viability, ameliorated sirt7ihblqs4/ihblqs4 hypoxia Figure 2 with image from Liao et al., 2023
whole organism hif1aa expression increased amount, abnormal sirt7ihblqs4/ihblqs4 hypoxia Figure 7 with image from Liao et al., 2023
whole organism serpine1 expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
nucleate erythrocyte increased amount, exacerbated sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism hif1aa expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 7 with image from Liao et al., 2023
whole organism cited2 expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism pkz expression increased amount, abnormal sirt7ihblqs7/ihblqs7 viral treatment: Sprivivirus cyprinus Fig. 4 from Liao et al., 2021
whole organism vegfaa expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism mxc expression increased amount, abnormal sirt7ihblqs7/ihblqs7 viral treatment: Sprivivirus cyprinus Fig. 4 from Liao et al., 2021
response to hypoxia increased magnitude, ameliorated sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism epoa expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism egln3 expression increased amount, abnormal sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism semi-viable, ameliorated sirt7ihblqs7/ihblqs7 viral treatment: Sprivivirus cyprinus Fig. 1Fig. 4 from Liao et al., 2021
whole organism lta expression increased amount, abnormal sirt7ihblqs7/ihblqs7 viral treatment: Sprivivirus cyprinus Fig. 4 from Liao et al., 2021
whole organism viability, ameliorated sirt7ihblqs7/ihblqs7 hypoxia Figure 3 with image from Liao et al., 2023
whole organism ifnphi1 expression increased amount, abnormal sirt7ihblqs7/ihblqs7 viral treatment: Sprivivirus cyprinus Fig. 4 from Liao et al., 2021
Citations