CRISPR

CRISPR1-dab2

ID
ZDB-CRISPR-160331-1
Name
CRISPR1-dab2
Previous Names
None
Target
Sequence
5' - GGTGATTGAGCATGAACATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-dab2
Expressed Gene Anatomy Figures
axin2 Fig. 4 with image from Hofsteen et al., 2016
dab2 Fig. 4 with image from Hofsteen et al., 2016
tcf3b Fig. 4 with image from Hofsteen et al., 2016
tcf7l1a Fig. 4 with image from Hofsteen et al., 2016
wnt3 Fig. 4 with image from Hofsteen et al., 2016
wnt5a Fig. 4 with image from Hofsteen et al., 2016
wnt8a Fig. 4 with image from Hofsteen et al., 2016
wnt10a Fig. 4 with image from Hofsteen et al., 2016
Phenotype
Phenotype resulting from CRISPR1-dab2
Phenotype Fish Figures
atrium cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
forebrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
hindbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
midbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
post-vent vasculature vasculature development decreased process quality, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
pronephros anterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
vasculature posterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism dab2 expression decreased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf7l1a expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism axin2 expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf3b expression increased amount, abnormal AB + CRISPR1-dab2 Fig. 4 with image from Hofsteen et al., 2016
Phenotype of all Fish created by or utilizing CRISPR1-dab2
Phenotype Fish Conditions Figures
whole organism dab2 expression decreased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf7l1a expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism tcf3b expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
whole organism axin2 expression increased amount, abnormal AB + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
atrium cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
midbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
forebrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
hindbrain mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
pronephros anterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
post-vent vasculature vasculature development decreased process quality, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
vasculature posterior region mCherry expression increased amount, abnormal ia5Tg/+; zn1Tg/+ + CRISPR1-dab2 standard conditions Fig. 4 with image from Hofsteen et al., 2016
heart physical object quality, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
heart physical object quality, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
whole organism malformed, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
whole organism morphology, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
cardiac muscle cell decreased amount, abnormal f2Tg/+; w32Tg/+ + CRISPR1-dab2 control Fig. 4 with image from Hofsteen et al., 2016
cardiac muscle cell amount, ameliorated f2Tg/+; w32Tg/+ + CRISPR1-dab2 heat shock Fig. 4 with image from Hofsteen et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.