CRISPR

CRISPR1-dand5

ID
ZDB-CRISPR-160128-125
Name
CRISPR1-dand5
Previous Names
  • Z000179 (1)
Target
Sequence
5' - GGACCAGACGAACCTGTTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
a204 dand5
Expression
Gene expression in Wild Types + CRISPR1-dand5
No data available
Phenotype
Phenotype resulting from CRISPR1-dand5
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dand5
Phenotype Fish Conditions Figures
heart jogging process quality, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with imageFig. 3 from Montague et al., 2018
heart looping decreased occurrence, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium right side lft2 expression mislocalised, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression increased amount, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping process quality, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression increased distribution, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm left side spaw expression mislocalised, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression increased amount, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
notochord lft1 expression increased distribution, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging decreased occurrence, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression increased amount, abnormal dand5a204/a204 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging process quality, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping decreased occurrence, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm right side spaw expression mislocalised, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with imageFig. 3 from Montague et al., 2018
notochord lft1 expression increased amount, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium right side lft2 expression mislocalised, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm left side spaw expression mislocalised, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression increased distribution, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping process quality, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression increased amount, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
whole organism medial region lft1 expression increased distribution, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging decreased occurrence, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord spaw expression mislocalised, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression increased amount, abnormal dand5a204/a204; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging process quality, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping decreased occurrence, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
heart jogging decreased occurrence, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping process quality, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
Kupffer's vesicle anatomical region spaw expression decreased amount, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium lft2 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
Citations