CRISPR

CRISPR1-apln

ID

ZDB-CRISPR-151016-3

Name

CRISPR1-apln

Previous Names

Z000165 (1)

Target

apln (2)

Sequence

5' - GAATGTGAAGATCTTGACGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

CRISPRz:Z000165 (1)

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mu267	apln

Expression

Gene expression in Wild Types + CRISPR1-apln

No data available

Phenotype

Phenotype resulting from CRISPR1-apln

No data available

Phenotype of all Fish created by or utilizing CRISPR1-apln

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	apln^mu267/mu267 + MO1-apln	standard conditions	Fig. S6 from Kwon et al., 2016
pericardium edematous, abnormal	apln^mu267/+ + MO1-apln	standard conditions	Fig. S6 from Kwon et al., 2016
regenerating tissue cell population proliferation decreased occurrence, abnormal	apln^mu267/mu267; hu5333Tg	cryoablation: heart	Fig. 1 from Marín-Juez et al., 2019
blood vessel endothelial cell cell population proliferation decreased occurrence, abnormal	apln^mu267/mu267; hu5333Tg	cryoablation: heart	Fig. 1 from Marín-Juez et al., 2019
angiogenic sprout decreased length, abnormal	apln^mu267/mu267; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis decreased occurrence, abnormal	apln^mu267/mu267; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	apln^mu267/mu267; y1Tg	standard conditions	Figure 4 from Helker et al., 2020
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	apela^zf439/+; apln^mu267/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	apela^zf439/+; apln^mu267/mu267; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	apela^zf439/zf439; apln^mu267/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	apela^zf439/zf439; apln^mu267/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	apela^zf439/zf439; apln^mu267/mu267; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	apela^zf439/zf439; apln^mu267/mu267; y1Tg	control	Fig. 2 from Helker et al., 2015
trunk sprouting angiogenesis decreased occurrence, abnormal	apela^zf439/zf439; apln^mu267/mu267; y1Tg	standard conditions	Figure 1 from Helker et al., 2020
parachordal vessel agenesis, abnormal	apln^mu267/mu267; bns9Tg; ubs1Tg	standard conditions	Fig. 4 from Kwon et al., 2016
trunk sprouting angiogenesis disrupted, abnormal	apln^mu267/mu267; y1Tg + MO4-dll4	standard conditions	Figure 4 from Helker et al., 2020
angiogenic sprout decreased length, abnormal	apln^mu267/mu267; y1Tg + MO4-dll4	standard conditions	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis decreased occurrence, abnormal	apln^mu267/mu267; y1Tg + MO4-dll4	standard conditions	Figure 4 from Helker et al., 2020

Citations