CRISPR

CRISPR1-neurod1

ID
ZDB-CRISPR-150811-1
Name
CRISPR1-neurod1
Previous Names
None
Target
Sequence
5' - GGACGACGAGGAAGAAGAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-neurod1
Expressed Gene Anatomy Figures
ascl1a Fig. 4 from Taylor et al., 2015
dla Fig. 4 from Taylor et al., 2015
dld Fig. 4 from Taylor et al., 2015
her4.1 Fig. 4 from Taylor et al., 2015
notch1a Fig. 4 from Taylor et al., 2015
Phenotype
Phenotype resulting from CRISPR1-neurod1
Phenotype Fish Figures
eye decreased size, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retina cell population proliferation increased occurrence, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retina Notch signaling pathway decreased occurrence, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal cone cell decreased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer dla expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer ascl1a expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer notch1a expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer her4.1 expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer dld expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer dla expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer dld expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer notch1a expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer her4.1 expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer ascl1a expression increased amount, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal AB + CRISPR1-neurod1 Fig. 4 from Taylor et al., 2015
Phenotype of all Fish created by or utilizing CRISPR1-neurod1
Phenotype Fish Conditions Figures
retinal inner nuclear layer notch1a expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer dld expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer notch1a expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
eye decreased size, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer dld expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer dla expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer ascl1a expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer her4.1 expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal inner nuclear layer her4.1 expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer dla expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal outer nuclear layer ascl1a expression increased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retina Notch signaling pathway decreased occurrence, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retinal cone cell decreased amount, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
retina cell population proliferation increased occurrence, abnormal AB + CRISPR1-neurod1 standard conditions Fig. 4 from Taylor et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.