Morpholino Name: MO3-pgk1
Target: pgk1 (1)
Sequence:
5' - GTCAGTTGGCATTTCTGTGTGGACT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This sequence appears to target multiple places in the genome. The author was contacted and verified that the sequence is correct and provided this information. "This exon seems to reflect an ancient transposon integration into the first intron of pgk1, and we noted a number of similar sequences throughout the genome. However, the sequence shows wide variation, and in most cases it appears that the coding region in exon 2 has not been maintained. So these other sequences may not be expressed, or if they are they may not be functional. " - Bruce B. Riley