Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
14	34.6 cM	z5435	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
14	36.6 cM	z5435	Mother of Pearl (MOP)	Postlethwait, John H.	Data
14	258.54 cR	Z5435	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
14	517.0 cR	z5435	Goodfellow T51 (T51)	Geisler, Robert	Data
14	33.1 cM	z5435	Heat Shock (HS)	Woods, Ian G.	Data
14	20.83 cM		Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
fk94e07	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
unp1106	STS	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fb12a01	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fc56f11	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fa02f07	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fb09d09	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
z11305	SSLP	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
cdx1a	GENE	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
z1536	SSLP	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fj82h06	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
fb57b01	EST	14		Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
unp1272	STS	14	5.0 cR	Davidson et al., 2006	Davidson and Zon (2006, Dev. Biol. 292(2):506-518) mapped cdx1a to LG14 using the goodfellow radiation hybrid panel.
z4203	SSLP	14		Fischer et al., 2003	Fischer, et al. (2003. Dev 130:3515-3524.) report fgf24 is physically mapped to LG14 between z5435 and z4203.
fgf24	GENE	14		Fischer et al., 2003	Fischer, et al. (2003. Dev 130:3515-3524.) report fgf24 is physically mapped to LG14 between z5435 and z4203.
z4203	SSLP	14		Fischer et al., 2003	Fischer, et a. (2003. Dev 130:3515-3524.) report mapping the ikat22030 mutation to LG14 between z5435 and z4203 on the MGH mapping panel.
t22030	Feature	14		Fischer et al., 2003	Fischer, et a. (2003. Dev 130:3515-3524.) report mapping the ikat22030 mutation to LG14 between z5435 and z4203 on the MGH mapping panel.
z1536	SSLP	14		Parichy et al., 2000	Parichy, et al. (2000. Dev 127:3031-3044.) used half tetrad centromere linkage analysis to map pantherj4e1 to LG14. They refined the location between z5435 and z1536 using a 161 individual mapping panel.
csf1ra	GENE	14		Parichy et al., 2000	Parichy, et al. (2000. Dev 127:3031-3044.) mapped csf1r between z5435 and z1536. This map position is supported by them mapping pantherj4e1 to the same interval using a combination of half tetrad centromere linkage analysis and a 161 individual mapping panel. Mutant locus panther corresponds to csf1r.
j4e1	Feature	14		Parichy et al., 2000	Parichy, et al. (2000. Dev 127:3031-3044.) used half tetrad centromere linkage analysis to map pantherj4e1 to LG14. They refined the location between z5435 and z1536 using a 161 individual mapping panel.
z1536	SSLP	14		Parichy et al., 2000	Parichy, et al. (2000. Dev 127:3031-3044.) mapped csf1r between z5435 and z1536. This map position is supported by them mapping pantherj4e1 to the same interval using a combination of half tetrad centromere linkage analysis and a 161 individual mapping panel. Mutant locus panther corresponds to csf1r.

OTHER MAPPING INFORMATION

Chr 14 Parichy et al., 2000 Parichy, et al. (2000. Dev 127:3031-3044.) used half tetrad centromere linkage analysis to map  ... Parichy, et al. (2000. Dev 127:3031-3044.) used half tetrad centromere linkage analysis to map pantherj4e1 to LG14. They refined the location between z5435 and z1536 using a 161 individual mapping panel.   Chr 14 Parichy et al., 2000 Parichy, et al. (2000. Dev 127:3031-3044.) mapped csf1r between z5435 and z1536. This map  ... Parichy, et al. (2000. Dev 127:3031-3044.) mapped csf1r between z5435 and z1536. This map position is supported by them mapping pantherj4e1 to the same interval using a combination of half tetrad centromere linkage analysis and a 161 individual mapping panel. Mutant locus panther corresponds to csf1r.   Chr 14 Fischer et al., 2003 Fischer, et al. (2003. Dev 130:3515-3524.) report fgf24 is physically mapped to LG14 between  ... Fischer, et al. (2003. Dev 130:3515-3524.) report fgf24 is physically mapped to LG14 between z5435 and z4203.   Chr 14 Fischer et al., 2003 Fischer, et a. (2003. Dev 130:3515-3524.) report mapping the ikat22030 mutation  ... Fischer, et a. (2003. Dev 130:3515-3524.) report mapping the ikat22030 mutation to LG14 between z5435 and z4203 on the MGH mapping panel.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	NA
Forward Primer	CCTTGTGCCCCTCAAATGCG
Reverse Primer	GTCATGGGAGGGAATGGTGC
AB	NA
Forward Primer	CCTTGTGCCCCTCAAATGCG
Reverse Primer	GTCATGGGAGGGAATGGTGC