Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	53.6 cM	z1406	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
2	160.7 cM	z1406	Mother of Pearl (MOP)	Postlethwait, John H.	Data
2	507.77 cR	Z1406	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
2	3714.0 cR	z1406	Goodfellow T51 (T51)	Geisler, Robert	Data
2	110.3 cM	z1406	Heat Shock (HS)	Woods, Ian G.	Data
2	76.26 cM		Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
gl2	Feature	2	3.8 cM	Hogan et al., 2006	Hogan, et al. (2006. Curr. Biol. 16:506-511) reports mapping gl2 to LG2, 3.8  ... Hogan, et al. (2006. Curr. Biol. 16:506-511) reports mapping gl2 to LG2, 3.8 cM from z1406.
z4586	SSLP	2	14.34 cM	Payne et al., 2001	Payne, et al. (2001. Mech Dev 100:275-289.) report mapping alk8 to LG02 on the MOP panel using a number of markers. The markers and distances between them are z4586-(2.3cM)-alk8-(4.76cM)-12L400-(3.64cM)-10F950-(3.64cM)-z1406.
12l400	RAPD	2	7.28 cM	Payne et al., 2001	Payne, et al. (2001. Mech Dev 100:275-289.) report mapping alk8 to LG02 on the MOP panel using a number of markers. The markers and distances between them are z4586-(2.3cM)-alk8-(4.76cM)-12L400-(3.64cM)-10F950-(3.64cM)-z1406.
10f950	RAPD	2	3.64 cM	Payne et al., 2001	Payne, et al. (2001. Mech Dev 100:275-289.) report mapping alk8 to LG02 on the MOP panel using a number of markers. The markers and distances between them are z4586-(2.3cM)-alk8-(4.76cM)-12L400-(3.64cM)-10F950-(3.64cM)-z1406.
acvr1l	GENE	2	12.04 cM	Payne et al., 2001	Payne, et al. (2001. Mech Dev 100:275-289.) report mapping alk8 to LG02 on the MOP panel using a number of markers. The markers and distances between them are z4586-(2.3cM)-alk8-(4.76cM)-12L400-(3.64cM)-10F950-(3.64cM)-z1406.
atp1a2a	GENE	2		Rajarao et al., 2001	Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1a2 to LG02 between z17291 and z1406. atp1a2 was previously mapped to LG02 on the T51 mapping panel.
z17291	SSLP	2		Rajarao et al., 2001	Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1a2 to LG02 between z17291 and z1406. atp1a2 was previously mapped to LG02 on the T51 mapping panel.
dnaaf11	GENE	2		Serluca et al., 2009	Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping  ... Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping lrrc6/seahorse to LG2 using markers Z1406 and Z8448.
z8448	SSLP	2		Serluca et al., 2009	Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping  ... Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping lrrc6/seahorse to LG2 using markers Z1406 and Z8448.

OTHER MAPPING INFORMATION

Chr 2 Rajarao et al., 2001 Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1a2 to LG02 between z17291 and z1406. atp1a2 was previously mapped to LG02 on the T51 mapping panel.   Chr 2 Serluca et al., 2009 Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping lrrc6/seahorse to LG2 using  ... Serluca, et al. (2009. Development 136(10): 1621-1631.) reports mapping lrrc6/seahorse to LG2 using markers Z1406 and Z8448.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	NA
Forward Primer	CGCCCGTTGAGGATACAG
Reverse Primer	CACAGTTCACAAAGCGCACT
IND	NA
Forward Primer	CGCCCGTTGAGGATACAG
Reverse Primer	CACAGTTCACAAAGCGCACT