Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
21	38.4 cM	z10960	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
21	264.75 cR	Z10960	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
21	2665.0 cR	z10960	Goodfellow T51 (T51)	Geisler, Robert	Data
21	90.8 cM	z10960	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z4425	SSLP	21		Starr et al., 2004	Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype  ... Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype chm identified in the ru848 line to LG 21. The phenotype cosegregated with z4425. Further characterization with additional markers revealed a second marker z10960 that was 7.2 cM distant on the other side of the mutation. Genotyping of 2000 mutant larvae revealed that there were only three recombinants between z10960 and chm while there there were 225 recombinants between z4425 and the mutant phenotype. Analyses of BACs containing z10960 revealed the presence of two genes dacha and chm in the region. Subsequent experiments revealed the presence of a nonsense mutation in the chm gene to be responsible for the mutant phenotype.
chm	GENE	21		Starr et al., 2004	Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype  ... Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype chm identified in the ru848 line to LG 21. The phenotype cosegregated with z4425. Further characterization with additional markers revealed a second marker z10960 that was 7.2 cM distant on the other side of the mutation. Genotyping of 2000 mutant larvae revealed that there were only three recombinants between z10960 and chm while there there were 225 recombinants between z4425 and the mutant phenotype. Analyses of BACs containing z10960 revealed the presence of two genes dacha and chm in the region. Subsequent experiments revealed the presence of a nonsense mutation in the chm gene to be responsible for the mutant phenotype.
dacha	GENE	21		Starr et al., 2004	Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype  ... Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype chm identified in the ru848 line to LG 21. The phenotype cosegregated with z4425. Further characterization with additional markers revealed a second marker z10960 that was 7.2 cM distant on the other side of the mutation. Genotyping of 2000 mutant larvae revealed that there were only three recombinants between z10960 and chm while there there were 225 recombinants between z4425 and the mutant phenotype. Analyses of BACs containing z10960 revealed the presence of two genes dacha and chm in the region. Subsequent experiments revealed the presence of a nonsense mutation in the chm gene to be responsible for the mutant phenotype.

OTHER MAPPING INFORMATION

Chr 21 Starr et al., 2004 Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype chm identified in the  ... Starr CJ et al. (Proc. Natl. Acad. Sci USA 2004) mapped the mutant phenotype chm identified in the ru848 line to LG 21. The phenotype cosegregated with z4425. Further characterization with additional markers revealed a second marker z10960 that was 7.2 cM distant on the other side of the mutation. Genotyping of 2000 mutant larvae revealed that there were only three recombinants between z10960 and chm while there there were 225 recombinants between z4425 and the mutant phenotype. Analyses of BACs containing z10960 revealed the presence of two genes dacha and chm in the region. Subsequent experiments revealed the presence of a nonsense mutation in the chm gene to be responsible for the mutant phenotype.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	170		60.0
Forward Primer	TCCCCGCTGAGTCCTCTATA
Reverse Primer	AGTGTGCGAGGTGTGTCAAG
IND	160,146		60.0
Forward Primer	TCCCCGCTGAGTCCTCTATA
Reverse Primer	AGTGTGCGAGGTGTGTCAAG
TU	160,146		60.0
Forward Primer	TCCCCGCTGAGTCCTCTATA
Reverse Primer	AGTGTGCGAGGTGTGTCAAG
EKW	170,0,182		60.0
Forward Primer	TCCCCGCTGAGTCCTCTATA
Reverse Primer	AGTGTGCGAGGTGTGTCAAG