ZFIN Mapping: m308

ZFIN ID: ZDB-GENE-980526-485

Gene Name:	POU domain, class 5, transcription factor 3
Symbol:	pou5f3

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN JBrowse	21	13,685,853 - 13,690,712	GRCz11
Ensembl	21	13,685,853 - 13,690,712	GRCz11
Vega	21	13,589,124 - 13,593,983	GRCv10
NCBI Map Viewer	21	13,685,853 - 13,690,719	GRCz11
UCSC	21	-	GRCz11

Mapped Clones containing pou5f3
CH73-205E12	Chr: 21 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Citations
e713	21	13,687,101	GRCz11	Burgess et al., 2002
hi349Tg	21	13,689,438 - 13,689,439	GRCz11	ZFIN Curated Data
hi1757Tg	21	13,692,718 - 13,692,719	GRCz11	ZFIN Curated Data
hi1940Tg	21	13,690,021 - 13,690,022	GRCz11	ZFIN Curated Data
ihb137	21	13,689,976 - 13,689,979	GRCz11	Zhang et al., 2020
m216	21	13,687,101	GRCz11	Belting et al., 2001
sa1294	21	13,687,075	GRCz11	Busch-Nentwich et al., 2013
	21	13,590,346	GRCz10	Busch-Nentwich et al., 2013
	21	11,889,172	Zv9	Busch-Nentwich et al., 2013
sa1329	21	13,690,432	GRCz11	Busch-Nentwich et al., 2013
	21	13,593,703	GRCz10	Busch-Nentwich et al., 2013
	21	11,892,529	Zv9	Busch-Nentwich et al., 2013
la013973Tg	21	11,890,655 - 11,890,665	Zv9

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
21	57.8 cM	pou2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
21	1331.0 cR	pou2	Goodfellow T51 (T51)	Geisler, Robert	Data
21	50.3 cM	pou2	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by pou5f3
chunp6868 Chr: 21 Details
fd18d06 Chr: 21 Details

Genomic Feature m793 is an allele of pou5f3

Marker	Type	Chr	Distance	Publication / Person	Comments
z21718	SSLP	21		Belting et al., 2001	Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spg^m793 mutant to LG21 between z12068 and z21718.
z12068	SSLP	21		Belting et al., 2001	Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. (2001. Dev 128:4165-4176.) report mapping the spg^m793 mutant to LG21 between z12068 and z21718.

Genomic Feature e713 is an allele of pou5f3

Marker	Type	Chr	Distance	Publication / Person	Comments
z13467	SSLP	21		Burgess et al., 2002	Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and the spg^e713 mutant phenotype among 39 haploid embryos obtained from a heterozygous carrier female.

Genomic Feature m793 is an allele of pou5f3

Chr 21

Using a panel of 2418 spg^m793/spg^m793 embryos, Belting, et al. ...

Genomic Feature e713 is an allele of pou5f3

Chr 21

Burgess et al. (2002 Development 129:905-916) reported no recombinants between the SSLP z13467 and ...

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	796	BfaI	36.0
Forward Primer	GCCCTTTGATGACGAGTGTG
Reverse Primer	TTGGAGATGGGAGAGTGCAA

Mapping Details