ZFIN ID: ZDB-GENE-980526-419 |
Gene Name: | LIM domain only 2 (rhombotin-like 1) |
---|---|
Symbol: | lmo2 |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing lmo2 | |
---|---|
DKEY-10O6 | Chr: 18 Details |
CH73-110E4 | Chr: 18 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
bns499 | 18 | 38,295,654 | GRCz11 | Mattonet et al., 2022 |
bns500 | 18 | 38,295,654 - 38,295,659 | GRCz11 | Mattonet et al., 2022 |
vu270 | 18 | 38,295,634 | GRCz11 | Weiss et al., 2012 |
zf3558 | 18 | 38,290,738 - 38,290,739 | GRCz11 | Matrone et al., 2021 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
18 | 102.7 cM | lmo2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
18 | 425.72 cR | lmo2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
18 | 3718.0 cR | lmo2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
18 | 86.6 cM | lmo2 | Heat Shock (HS) | Woods, Ian G. | Data |
18 | 60.9 cM | lmo2 | Gates et al (GAT) | Talbot, William S. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
z3853 | SSLP | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. | |
onecut1 | GENE | 18 | 30.0 cR | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. |
fc83a08 | EST | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. | |
fb96a11 | EST | 18 | Matthews et al., 2004 | Matthews et al. (2004. Dev. Biol. 274(2):245-259) mapped onecut1 to LG18 using a radiation hybrid panel. |
Markers Encoded by lmo2 | |||
---|---|---|---|
fc83a08 Chr: 18 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | HhaI | 36.0 | |
Forward Primer | CCACAAACAAGACGGAGCCTA | ||
Reverse Primer | CGCACAAACGCTTCAGAGAT |
Genomic Feature zf3558 is an allele of lmo2 |