ZFIN ID: ZDB-GENE-980526-29 |
Gene Name: | deltaA |
---|---|
Symbol: | dla |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing dla | |
---|---|
CH211-133L11 | Chr: 1 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
dx2 | 1 | 54,018,777 | GRCz11 | Appel et al., 1999 |
hi781Tg | 1 | 54,014,034 - 54,014,035 | GRCz11 | ZFIN Curated Data |
hi840Tg | 1 | 54,014,153 - 54,014,154 | GRCz11 | ZFIN Curated Data |
hi3499Tg | 1 | 54,013,553 - 54,013,554 | GRCz11 | ZFIN Curated Data |
ion29h | 1 | 54,014,249 - 54,014,252 | GRCz11 | Jin et al., 2022 |
sa19611 | 1 | 54,014,790 | GRCz11 | Busch-Nentwich et al., 2013 |
1 | 53,355,047 | GRCz10 | Busch-Nentwich et al., 2013 | |
1 | 54,581,544 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
1 | 167.3 cM | deltaa | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
1 | 6594.0 cR | dla | Goodfellow T51 (T51) | Geisler, Robert | Data |
1 | 92.9 cM | dla | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Markers Encoded by dla | |||
---|---|---|---|
fa04c10 Chr: 1 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 452 | 36.0 | |
Forward Primer | GAGCGGCGGGAGAAGGAC | ||
Reverse Primer | TGGCAGAGCAGCATGTAGAGGA |
Genomic Feature sa19611 is an allele of dla |