ZFIN ID: ZDB-GENE-980526-168 |
Gene Name: | cyclin E1 |
---|---|
Symbol: | ccne1 |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing ccne1 | |
---|---|
DKEY-56M16 | Chr: 7 Details |
CH211-260E23 | Chr: 7 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa8454 | 7 | 46,025,940 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 45,753,574 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 47,635,463 | Zv9 | Busch-Nentwich et al., 2013 | |
sa17090 | 7 | 46,025,497 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 45,753,131 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 47,635,020 | Zv9 | Busch-Nentwich et al., 2013 | |
sa25369 | 7 | 46,025,786 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 45,753,420 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 47,635,309 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
7 | 111.6 cM | cyce | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
7 | 176.01 cR | cyce | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
7 | 94.5 cM | ccne | Heat Shock (HS) | Woods, Ian G. | Data |
7 | 75.84 cM | cyce | Gates et al (GAT) | Talbot, William S. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
z1182 | SSLP | 7 | 7.5 cM | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
isl2b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
foxb1b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z1059 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z3445 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z4706 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
ache | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
en2a | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
shha | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
Markers Encoded by ccne1 | |||
---|---|---|---|
fa18e07 Chr: 7 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 563 | Tsp509I | 36.0 |
Forward Primer | AGAGAGCACCATCTCTTGACTT | ||
Reverse Primer | CAAACACTCAGAAGTTGACCAG |
Genomic Feature sa17090 is an allele of ccne1 |