ZFIN ID: ZDB-GENE-980526-561 |
Gene Name: | myogenic differentiation 1 |
---|---|
Symbol: | myod1 |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing myod1 | |
---|---|
CH211-201M7 | Chr: 25 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
fh261 | 25 | 31,422,905 | GRCz11 | ZFIN Curated Data |
hu2023 | 25 | 31,422,131 | GRCz11 | Busch-Nentwich et al., 2013 |
25 | 30,844,655 | GRCz10 | Busch-Nentwich et al., 2013 | |
25 | 32,265,402 | Zv9 | Busch-Nentwich et al., 2013 | |
hu2024 | 25 | 31,421,995 | GRCz11 | Busch-Nentwich et al., 2013 |
25 | 30,844,519 | GRCz10 | Busch-Nentwich et al., 2013 | |
25 | 32,265,266 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
25 | 114.3 cM | myod | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
25 | 365.81 cR | myod | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
25 | 3341.0 cR | myod | Goodfellow T51 (T51) | Geisler, Robert | Data |
25 | 72.5 cM | myod | Heat Shock (HS) | Woods, Ian G. | Data |
25 | 76.6 cM | myod | Gates et al (GAT) | Talbot, William S. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
lamb4 | GENE | 25 | Parsons et al., 2002 | Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25 approximately 0.42 cM from myod on the MOP mapping panel. Using the LN54 mapping panel, Parsons, et al. localize lamb1 approximately 20 cR away from myod and also found an EST (fa05e06) that corresponds to lamb4 that maps between myod and lamb1. | |
lamb1a | GENE | 25 | 20.0 cR | Parsons et al., 2002 | Parsons, et al. (2002. Dev 129:3137-3146.) report mapping lamb1 to LG25 approximately 0.42 cM from myod on the MOP mapping panel. Using the LN54 mapping panel, Parsons, et al. localize lamb1 approximately 20 cR away from myod and also found an EST (fa05e06) that corresponds to lamb4 that maps between myod and lamb1. |
Markers Encoded by myod1 | |||
---|---|---|---|
fb57a01 Chr: 25 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 750 | DdeI | 36.0 |
Forward Primer | ATGAGGGATCTGTCCTGAGTG | ||
Reverse Primer | TTGTTCGTTTTCGTCGCTTT |
Genomic Feature fh261 is an allele of myod1 |