ZFIN ID: ZDB-GENE-980526-330

Mapping Details

Gene Name:	caudal type homeobox 4
Symbol:	cdx4

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN JBrowse	14	32,961,718 - 32,965,169	GRCz11
Ensembl	14	32,961,718 - 32,965,169	GRCz11
Vega	14	32,621,404 - 32,624,855	GRCv10
NCBI Map Viewer	14	32,961,703 - 32,965,169	GRCz11
UCSC	14	-	GRCz11

Mapped Clones containing cdx4
CH211-231B5	Chr: 14 Details
CH211-276G21	Chr: 14 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Citations
ch107	14	32,965,088	GRCz11	Rocha et al., 2021
hi2092Tg	14	32,964,321 - 32,964,322	GRCz11	ZFIN Curated Data
hi2188aTg	14	32,964,452 - 32,964,453	GRCz11	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
14	117.4 cM	cad1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
14	84.5 cM	cad1	Heat Shock (HS)	Woods, Ian G.	Data
14	71.88 cM	cad1	Gates et al (GAT)	Talbot, William S.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Chr 14

ZFIN Curated Data

ZFIN historical data

Markers Encoded by cdx4
zk14a10.t7 Chr: 5 Details

Genomic Feature tl240a is an allele of cdx4

Chr	Location	Mapped As	Panel	Mapped By	Scoring
14	57.2 cM	tl240a	Boston MGH Cross (MGH)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Genomic Feature tv205c is an allele of cdx4

Marker	Type	Chr	Distance	Publication / Person	Comments
kdrl	GENE	14	2.0 cR	Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fb79h04	EST	14	26.0 cR	Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fa10f09	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fc54b04	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fb75e04	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fc41g06	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fd02c12	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
fj63c09	EST	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
chic1	GENE	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
z11437	SSLP	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
z13401	SSLP	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.
z20545	SSLP	14		Davidson et al., 2003	Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kgg^tv205 to LG14 using the Goodfellow radiaion hybrid panel.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	271		36.0
Forward Primer	AGGCAAGCATGTATCACCAAGGAG
Reverse Primer	TAATCGGGCGAGCAATAGGAAACT

Genomic Feature hi2188aTg is an allele of cdx4