Genomic Feature
umo79
- ID
- ZDB-ALT-250122-9
- Name
- umo79
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one delins (1)
- Protocol
- embryos treated with
- Lab of Origin
- Wei Ge Lab
- Current Source
- Other Pages
-
Notes
| Comment | Citation |
|---|---|
| Chromosome 7, insertion of AATACTATTTATCTAAGTTAATACTT (26 bp) and deletion of ... | Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Delins
- Variant Location
- Chr 7: 15543875 - 15543890 (GRCz11) (1) Details
- Nucleotide change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 26 bp inserted / 16 bp deleted (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
-
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None