TALEN

TALEN1-runx1

ID
ZDB-TALEN-230817-1
Name
TALEN1-runx1
Previous Names
None
Target
Target Sequence 1
5' - TTGCCCTTGGTGATATCCCAG - 3'
Target Sequence 2
5' - TCATCATTTCCCGCCATCACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hg96 runx1
hg97 runx1
Expression
Gene expression in Wild Types + TALEN1-runx1
No data available
Phenotype
Phenotype resulting from TALEN1-runx1
No data available
Phenotype of all Fish created by or utilizing TALEN1-runx1
Phenotype Fish Conditions Figures
kidney myeloid cell mpx expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte thbs1b expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte apln expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte mpl expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte itgb3a expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte itga2b expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney myeloid cell lyz expression decreased amount, abnormal runx1hg96/hg96 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney myeloid cell mpx expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte thbs1b expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte apln expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte mpl expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte itgb3a expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney myeloid cell lyz expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
kidney thrombocyte itga2b expression decreased amount, abnormal runx1hg97/hg97 standard conditions Figure 1. with image from Bresciani et al., 2021
hematopoietic cell meis1b expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 2. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell meis1b expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
thrombocyte EGFP expression decreased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 1. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell meis1b expression spatial pattern, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell fli1 expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
hematopoietic cell gata2b expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell gata2b expression spatial pattern, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
hematopoietic cell fli1 expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell fli1 expression spatial pattern, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with image from Bresciani et al., 2021
nucleate erythrocyte DsRed expression decreased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 1. with image from Bresciani et al., 2021
ventral wall of dorsal aorta regulation of hematopoietic stem cell migration decreased rate, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 2. with image from Bresciani et al., 2021
hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal runx1hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg standard conditions Figure 4. with imageFigure 5. with image from Bresciani et al., 2021
whole organism viability, abnormal runx1hg96/hg96; gata2bhg94/hg94 standard conditions Figure 6. with image from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal en.gata2a.i4hg123/+; gata2bhg95/hg95; runx1hg96/hg96 standard conditions Figure 6. with image from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal en.gata2a.i4hg123/hg123; gata2bhg95/+; runx1hg96/hg96 standard conditions Figure 6. with image from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal en.gata2a.i4hg123/hg123; gata2bhg95/hg95; runx1hg96/hg96 standard conditions Figure 6. with image from Bresciani et al., 2021
Citations