TALEN

TALEN1-ahi1

ID
ZDB-TALEN-170314-2
Name
TALEN1-ahi1
Previous Names
None
Target
Target Sequence 1
5' - TGTCAGCAGAAAACCAGACAG - 3'
Target Sequence 2
5' - TCCTCCTTGAACTCCTCTACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lri46 ahi1
lri47 ahi1
lri53 ahi1
Expression
Gene expression in Wild Types + TALEN1-ahi1
No data available
Phenotype
Phenotype resulting from TALEN1-ahi1
No data available
Phenotype of all Fish created by or utilizing TALEN1-ahi1
Phenotype Fish Conditions Figures
post-vent region curved ventral, abnormal ahi1lri46/lri46 standard conditions Fig. 1 with image from Lessieur et al., 2017
retinal cone cell has fewer parts of type retinal cone cell photoreceptor outer segment, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
whole organism lacks all parts of type swim bladder, abnormal ahi1lri46/lri46 standard conditions Fig. 1 with image from Lessieur et al., 2017
retinal outer nuclear layer dorsal region decreased thickness, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
photoreceptor outer segment layer dorsal region malformed, abnormal ahi1lri46/lri46 standard conditions Fig. 4 with image from Lessieur et al., 2017
retinal cone cell photoreceptor cell outer segment organization decreased process quality, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 7 with image from Lessieur et al., 2017
posterior pronephric duct lacks all parts of type posterior pronephric duct motile cilium, abnormal ahi1lri46/lri46 standard conditions Fig. 2 with image from Lessieur et al., 2017
retinal cone cell development decreased process quality, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 7 with image from Lessieur et al., 2017
retinal cone cell lacks all parts of type retinal cone cell photoreceptor outer segment, abnormal ahi1lri46/lri46 standard conditions Fig. 7 with image from Lessieur et al., 2017
pronephric duct cilium assembly decreased occurrence, abnormal ahi1lri46/lri46 standard conditions Fig. 2 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment irregular spatial pattern, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with image from Lessieur et al., 2017
retinal cone cell photoreceptor disc membrane irregular spatial pattern, abnormal ahi1lri46/lri46 standard conditions Fig. 5 with image from Lessieur et al., 2017
retinal outer nuclear layer zpr-3 labeling mislocalised, abnormal ahi1lri46/lri46 standard conditions Fig. 6 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment decreased length, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 5 with imageFig. 7 with image from Lessieur et al., 2017
retinal cone cell photoreceptor outer segment disorganized, abnormal ahi1lri46/lri46 standard conditions Fig. 3 with imageFig. 5 with image from Lessieur et al., 2017
eye photoreceptor cell photoreceptor connecting cilium cc2d2a expression decreased amount, abnormal ahi1lri46/lri46 standard conditions Fig. 9 with image from Lessieur et al., 2017
retinal cone cell cone photoreceptor outer segment decreased amount, abnormal cep290fh297/fh297; ahi1lri46/+ standard conditions Fig 9 with image from Lessieur et al., 2019
optokinetic behavior decreased process quality, abnormal cep290fh297/fh297; ahi1lri46/+ standard conditions Fig. 12 from Lessieur et al., 2019
retinal cone cell decreased amount, abnormal cep290fh297/fh297; ahi1lri46/+ standard conditions Fig 9 with image from Lessieur et al., 2019
photoreceptor inner segment layer zpr-3 labeling mislocalised, abnormal cep290fh297/fh297; ahi1lri46/+ standard conditions Fig 9 with image from Lessieur et al., 2019
optokinetic behavior decreased process quality, abnormal cep290fh297/fh297; ahi1lri46/lri46 standard conditions Fig. 12 from Lessieur et al., 2019
whole organism decreased life span, abnormal cep290fh297/fh297; ahi1lri46/lri46 standard conditions text only from Lessieur et al., 2019
whole organism dead, abnormal cep290fh297/fh297; ahi1lri46/lri46 standard conditions text only from Lessieur et al., 2019
Citations