TALEN

TALEN1-adgrg1

ID
ZDB-TALEN-151029-1
Name
TALEN1-adgrg1
Previous Names
None
Target
Target Sequence 1
5' - GTTTCTCCCTAGACAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl
Target Sequence 2
5' - AACTGTATCGCAGCCATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
stl13 adgrg1
stl14 adgrg1
Expression
Gene expression in Wild Types + TALEN1-adgrg1
No data available
Phenotype
Phenotype resulting from TALEN1-adgrg1
No data available
Phenotype of all Fish created by or utilizing TALEN1-adgrg1
Phenotype Fish Conditions Figures
posterior lateral line nerve myelin sheath surrounding posterior lateral line nerve axon, abnormal adgrg1stl13/stl13 standard conditions Fig. S2 from Ackerman et al., 2018
myelin maintenance disrupted, abnormal adgrg1stl13/stl13 standard conditions Fig. S2 from Ackerman et al., 2018
posterior lateral line nerve axon decreased amount, abnormal adgrg1stl13/stl13 standard conditions Fig. S2 from Ackerman et al., 2018
myelinating Schwann cell cytoplasm surrounding posterior lateral line nerve myelin sheath, abnormal adgrg1stl13/stl13 standard conditions Fig. S2 from Ackerman et al., 2018
posterior lateral line nerve myelin sheath morphology, abnormal adgrg1stl13/stl13 standard conditions Fig. S2 from Ackerman et al., 2018
spinal cord central nervous system myelination decreased occurrence, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 3 from Ackerman et al., 2015
spinal cord has fewer parts of type spinal cord oligodendrocyte, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord has fewer parts of type spinal cord oligodendrocyte, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord oligodendrocyte mbpa expression decreased amount, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord oligodendrocyte mbpa expression decreased amount, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
oligodendrocyte development decreased process quality, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
oligodendrocyte development decreased process quality, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord oligodendrocyte nkx2.2a expression decreased amount, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord ventral region has fewer parts of type spinal cord myelin sheath, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 3 from Ackerman et al., 2015
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/stl13 (AB) control Fig. 7 from Ackerman et al., 2015
spinal cord central nervous system myelination premature, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 5 from Ackerman et al., 2015
spinal cord central nervous system myelination increased occurrence, abnormal adgrg1stl13/stl13 (AB) standard conditions Fig. 5 from Ackerman et al., 2015
spinal cord central nervous system myelination decreased occurrence, abnormal adgrg1stl14/stl14 (AB) standard conditions Fig. 3 from Ackerman et al., 2015
spinal cord ventral region has fewer parts of type spinal cord myelin sheath, abnormal adgrg1stl14/stl14 (AB) standard conditions Fig. 3 from Ackerman et al., 2015
spinal cord oligodendrocyte mbpa expression decreased amount, abnormal adgrg1stl14/stl14 (AB) standard conditions Fig. 2 from Ackerman et al., 2015
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/+ (AB) control Fig. 7 from Ackerman et al., 2015
spinal cord axon ensheathment in central nervous system decreased occurrence, abnormal adgrg1stl13/stl13; vu234Tg standard conditions Fig. 5 from Ackerman et al., 2015
oligodendrocyte progenitor proliferation decreased occurrence, abnormal adgrg1stl13/stl13; vu234Tg standard conditions Fig. 5 from Ackerman et al., 2015
spinal cord axon ensheathment in central nervous system premature, abnormal adgrg1stl13/stl13; vu234Tg standard conditions Fig. 5 from Ackerman et al., 2015
myelination of posterior lateral line nerve axons disrupted, abnormal adgrg1stl13/+ + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 from Ackerman et al., 2018
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/+ + MO1-gna12a + MO1-gna13a + MO1-gna13b (AB) standard conditions Fig. 7 from Ackerman et al., 2015
myelination of posterior lateral line nerve axons disrupted, abnormal adgrg1stl13/stl13 + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 from Ackerman et al., 2018
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/stl13 + MO1-gna12a + MO1-gna13a + MO1-gna13b (AB) standard conditions Fig. 7 from Ackerman et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.