TALEN

TALEN1-aplnra

ID

ZDB-TALEN-151016-1

Name

TALEN1-aplnra

Previous Names

None

Target

aplnra (1)

Target Sequence 1

5' - GAATACACCGAGACATACGAT - 3'

Target Sequence 2

5' - TCACACCCAGAGTCATTATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mu296	aplnra

Expression

Gene expression in Wild Types + TALEN1-aplnra

No data available

Phenotype

Phenotype resulting from TALEN1-aplnra

No data available

Phenotype of all Fish created by or utilizing TALEN1-aplnra

Phenotype	Fish	Conditions	Figures
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/+; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/+; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/+; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/mu270; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/mu270; aplnra^mu296/+; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline arrested, abnormal	aplnrb^mu270/mu270; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
angioblast cell migration from lateral mesoderm to midline process quality, abnormal	aplnrb^mu270/mu270; aplnra^mu296/mu296; y1Tg	control	Fig. 2 from Helker et al., 2015
trunk sprouting angiogenesis decreased occurrence, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; y1Tg	standard conditions	Figure 1 from Helker et al., 2020
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; y7Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/+; aplnra^mu296/+; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
trunk angiogenic sprout mislocalised, abnormal	aplnrb^mu281/+; aplnra^mu296/+; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
endothelial tip cell filopodium decreased length, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
endothelial tube lumen extension involved in blood vessel lumen ensheathment delayed, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
angiogenic sprout decreased length, abnormal	aplnrb^mu281/mu281; aplnra^mu296/+; mu280Tg	standard conditions	Figure 2 from Helker et al., 2020
trunk angiogenic sprout mislocalised, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; fr13Tg	heat shock	Figure 4 from Helker et al., 2020
trunk sprouting angiogenesis disrupted, abnormal	aplnrb^mu281/mu281; aplnra^mu296/mu296; fr13Tg	heat shock	Figure 4 from Helker et al., 2020

Citations