Morpholino
MO2-osbpl7
- ID
- ZDB-MRPHLNO-250217-2
- Name
- MO2-osbpl7
- Previous Names
- None
- Target
- Sequence
-
5' - GTGCCAACTGTAAAATGACTTACTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-osbpl7
No data available
Phenotype
Phenotype resulting from MO2-osbpl7
Phenotype of all Fish created by or utilizing MO2-osbpl7
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| pronephric glomerulus morphology, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5 
from Duara et al., 2024 |
| glomerular basement membrane ruptured, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5
from Duara et al., 2024 |
| podocyte shortened, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5
from Duara et al., 2024 |
| podocyte decreased thickness, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5
from Duara et al., 2024 |
| glomerular filtration decreased process quality, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5 ,
Fig. S1
from Duara et al., 2024 |
| pericardium edematous, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5 ,
Fig. S1
from Duara et al., 2024 |
| eye EGFP expression decreased amount, abnormal | lri500Tg + MO2-osbpl7 | control |
Fig. 5
from Duara et al., 2024 |
Citations