Morpholino

MO4-celsr3

ID
ZDB-MRPHLNO-241107-2
Name
MO4-celsr3
Previous Names
  • TB-MO-204 (1)
Target
Sequence
5' - GTCTTCTGCAATCACCCACTCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-celsr3
No data available
Phenotype
Phenotype resulting from MO4-celsr3
Phenotype Fish Figures
motor neuron GFP expression spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
motor neuron axon decreased length, abnormal sb2Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
post-vent region kinked, abnormal AB/TL + MO4-celsr3 Fig. 4 with image from Stegmann et al., 2024
post-vent region knobbled, abnormal AB/TL + MO4-celsr3 Fig. 4 with image from Stegmann et al., 2024
pronephric glomerulus dilated, abnormal li1Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
pronephric glomerulus EGFP expression spatial pattern, abnormal li1Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
pronephric tubule decreased size, abnormal li1Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
pronephric tubule EGFP expression spatial pattern, abnormal li1Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
spinal cord morphology, abnormal sb2Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
spinal cord GFP expression spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
spinal cord neuronal stem cell spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) Fig. 4 with image from Stegmann et al., 2024
Phenotype of all Fish created by or utilizing MO4-celsr3
Phenotype Fish Conditions Figures
post-vent region kinked, abnormal AB/TL + MO4-celsr3 control Fig. 4 with image from Stegmann et al., 2024
post-vent region knobbled, abnormal AB/TL + MO4-celsr3 control Fig. 4 with image from Stegmann et al., 2024
pronephric glomerulus EGFP expression spatial pattern, abnormal li1Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
pronephric glomerulus dilated, abnormal li1Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
pronephric tubule decreased size, abnormal li1Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
pronephric tubule EGFP expression spatial pattern, abnormal li1Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
spinal cord neuronal stem cell spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
spinal cord GFP expression spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
motor neuron GFP expression spatial pattern, abnormal sb2Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
spinal cord morphology, abnormal sb2Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
motor neuron axon decreased length, abnormal sb2Tg + MO4-celsr3 (AB/TL) control Fig. 4 with image from Stegmann et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.