Morpholino

MO1-sash1a

ID

ZDB-MRPHLNO-240927-1

Name

MO1-sash1a

Previous Names

None

Target

Sequence

5' - GTGCATTGAGAATTTCTTACTTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-sash1a

Expressed Gene	Anatomy	Figures
sash1a	whole organism	Fig. 1 from Zhou et al., 2023

Phenotype

Phenotype resulting from MO1-sash1a

Phenotype	Fish	Figures
brain edematous, abnormal	mi2001Tg + MO1-sash1a (TU)	Fig. 3 from Zhou et al., 2023
hindbrain astrocyte direction, abnormal	mi2001Tg + MO1-sash1a (TU)	Fig. 3, Fig. 4 from Zhou et al., 2023
hindbrain astrocyte GFP expression spatial pattern, abnormal	ml2Tg + MO1-sash1a (TU)	Fig. 4 from Zhou et al., 2023
hindbrain astrocyte spatial pattern, abnormal	mi2001Tg + MO1-sash1a (TU)	Fig. 3, Fig. 4 from Zhou et al., 2023
hindbrain astrocyte EGFP expression spatial pattern, abnormal	hkz04tTg + MO1-sash1a (TU)	Fig. 3 from Zhou et al., 2023
hindbrain microglial cell decreased amount, abnormal	hkz04tTg + MO1-sash1a (TU)	Fig. 2 from Zhou et al., 2023
hindbrain microglial cell EGFP expression decreased distribution, abnormal	hkz04tTg + MO1-sash1a (TU)	Fig. 2 from Zhou et al., 2023
swimming behavior increased process quality, abnormal	TU + MO1-sash1a	Fig. 5 from Zhou et al., 2023
whole organism sash1a expression decreased amount, abnormal	TU + MO1-sash1a	Fig. 1 from Zhou et al., 2023

Phenotype of all Fish created by or utilizing MO1-sash1a

Phenotype	Fish	Conditions	Figures
swimming behavior increased process quality, abnormal	TU + MO1-sash1a	control	Fig. 5 from Zhou et al., 2023
whole organism sash1a expression decreased amount, abnormal	TU + MO1-sash1a	control	Fig. 1 from Zhou et al., 2023
hindbrain microglial cell EGFP expression decreased distribution, abnormal	hkz04tTg + MO1-sash1a (TU)	control	Fig. 2 from Zhou et al., 2023
hindbrain astrocyte EGFP expression spatial pattern, abnormal	hkz04tTg + MO1-sash1a (TU)	control	Fig. 3 from Zhou et al., 2023
hindbrain microglial cell decreased amount, abnormal	hkz04tTg + MO1-sash1a (TU)	control	Fig. 2 from Zhou et al., 2023
hindbrain astrocyte spatial pattern, abnormal	mi2001Tg + MO1-sash1a (TU)	control	Fig. 3, Fig. 4 from Zhou et al., 2023
hindbrain astrocyte direction, abnormal	mi2001Tg + MO1-sash1a (TU)	control	Fig. 3, Fig. 4 from Zhou et al., 2023
brain edematous, abnormal	mi2001Tg + MO1-sash1a (TU)	control	Fig. 3 from Zhou et al., 2023
hindbrain astrocyte GFP expression spatial pattern, abnormal	ml2Tg + MO1-sash1a (TU)	control	Fig. 4 from Zhou et al., 2023

Citations