Morpholino

MO1-zfp36l2

ID
ZDB-MRPHLNO-240923-1
Name
MO1-zfp36l2
Previous Names
None
Target
Sequence
5' - CTGTTGCTCATGTTGAAGTCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zfp36l2
Expressed Gene Anatomy Figures
zfp36l2 Fig. 4 from Sun et al., 2024
Phenotype
Phenotype resulting from MO1-zfp36l2
Phenotype Fish Figures
embryonic heart tube development process quality, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
eye decreased size, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
forebrain hypoplastic, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
hindbrain development delayed, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
midbrain decreased size, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
pericardium edematous, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
pharyngeal arch decreased size, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
swim bladder development disrupted, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
swim bladder formation delayed, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
upper lip cleft, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
ventral mandibular arch hypoplastic, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
whole organism zfp36l2 expression decreased amount, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
yolk syncytial layer physical object quality, abnormal WT + MO1-zfp36l2 Fig. 4 from Sun et al., 2024
Phenotype of all Fish created by or utilizing MO1-zfp36l2
Phenotype Fish Conditions Figures
hindbrain development delayed, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
upper lip cleft, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
ventral mandibular arch hypoplastic, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
forebrain hypoplastic, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
swim bladder formation delayed, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
pericardium edematous, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
swim bladder development disrupted, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
midbrain decreased size, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
yolk syncytial layer physical object quality, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
pharyngeal arch decreased size, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
embryonic heart tube development process quality, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
eye decreased size, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
whole organism zfp36l2 expression decreased amount, abnormal WT + MO1-zfp36l2 standard conditions Fig. 4 from Sun et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.