Morpholino
MO1-nkx2.3
- ID
- ZDB-MRPHLNO-240918-1
- Name
- MO1-nkx2.3
- Previous Names
- None
- Target
- Sequence
-
5' - GAAGCATCATCAGGCGCTAAATGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nkx2.3
No data available
Phenotype
Phenotype resulting from MO1-nkx2.3
Phenotype | Fish | Figures |
---|---|---|
head decreased size, abnormal | TU + MO1-nkx2.3 |
Fig. 1
from Yang et al., 2023 |
mandibular arch skeleton decreased size, abnormal | TU + MO1-nkx2.3 |
Fig. 1
from Yang et al., 2023 |
Phenotype of all Fish created by or utilizing MO1-nkx2.3
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
head decreased size, abnormal | TU + MO1-nkx2.3 | control |
Fig. 1
from Yang et al., 2023 |
mandibular arch skeleton decreased size, abnormal | TU + MO1-nkx2.3 | control |
Fig. 1
from Yang et al., 2023 |
head decreased size, abnormal | tp53zdf1/zdf1 + MO1-nkx2.3 (TU) | control |
Fig. 1
from Yang et al., 2023 |
mandibular arch skeleton decreased size, abnormal | tp53zdf1/zdf1 + MO1-nkx2.3 (TU) | control |
Fig. 1
from Yang et al., 2023 |
Citations