Morpholino

MO1-clic5b

ID

ZDB-MRPHLNO-240909-1

Name

MO1-clic5b

Previous Names

Target

Sequence

5' - CCAGCCTACAAACACAACCACACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-clic5b

Phenotype

Phenotype resulting from MO1-clic5b

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	AB/TL + MO1-clic5b	Figure 3 from Ott et al., 2023
heart looping process quality, abnormal	AB/TL + MO1-clic5b	Figure 3 from Ott et al., 2023
otolith mislocalised, abnormal	li1Tg + MO1-clic5b	Figure 3 from Ott et al., 2023
otolith development process quality, abnormal	li1Tg + MO1-clic5b	Figure 3 from Ott et al., 2023
pronephric glomerulus decreased functionality, abnormal	uf4Tg + MO1-clic5b	Figure 4 from Ott et al., 2023
pronephric tubule Ab3-ezr labeling decreased amount, abnormal	AB/TL + MO1-clic5b	Figure 5 from Ott et al., 2023
pronephros cystic, abnormal	li1Tg + MO1-clic5b	Figure 3 from Ott et al., 2023
pronephros cilium decreased amount, abnormal	AB/TL + MO1-clic5b	Figure 4 from Ott et al., 2023
pronephros cilium assembly decreased process quality, abnormal	AB/TL + MO1-clic5b	Figure 4 from Ott et al., 2023
whole organism curved ventral, abnormal	AB/TL + MO1-clic5b	Figure 3 from Ott et al., 2023
whole organism ab1-ezr labeling decreased amount, abnormal	AB/TL + MO1-clic5b	Figure 5 from Ott et al., 2023
whole organism lef1 expression increased amount, abnormal	AB/TL + MO1-clic5b	Figure 4 from Ott et al., 2023
whole organism wnt8a expression increased amount, abnormal	AB/TL + MO1-clic5b	Figure 4 from Ott et al., 2023

Phenotype of all Fish created by or utilizing MO1-clic5b

Phenotype	Fish	Conditions	Figures
pronephric tubule Ab3-ezr labeling decreased amount, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 5 from Ott et al., 2023
whole organism wnt8a expression increased amount, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 4 from Ott et al., 2023
pronephros cilium decreased amount, abnormal	AB/TL + MO1-clic5b	control	Figure 4 from Ott et al., 2023
heart looping process quality, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
brain hydrocephalic, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
whole organism lef1 expression increased amount, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 4 from Ott et al., 2023
whole organism curved ventral, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
whole organism ab1-ezr labeling decreased amount, abnormal	AB/TL + MO1-clic5b	standard conditions	Figure 5 from Ott et al., 2023
pronephros cilium assembly decreased process quality, abnormal	AB/TL + MO1-clic5b	control	Figure 4 from Ott et al., 2023
pronephros cystic, abnormal	li1Tg + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
otolith mislocalised, abnormal	li1Tg + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
otolith development process quality, abnormal	li1Tg + MO1-clic5b	standard conditions	Figure 3 from Ott et al., 2023
pronephric glomerulus decreased functionality, abnormal	uf4Tg + MO1-clic5b	control	Figure 4 from Ott et al., 2023

Citations