Morpholino

MO2-plxna1a

ID

ZDB-MRPHLNO-230519-4

Name

MO2-plxna1a

Previous Names

None

Target

plxna1a (1)

Sequence

5' - AAGGAGATGCAGATACTTACACACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-plxna1a

No data available

Phenotype

Phenotype resulting from MO2-plxna1a

Phenotype	Fish	Figures
brain decreased size, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
brain hydrocephalic, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
brain development decreased process quality, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
camera-type eye development decreased process quality, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
cerebellum hypoplastic, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
dorsal root ganglion development decreased process quality, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
eye decreased diameter, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
eye developmental pigmentation decreased process quality, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
forebrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
forebrain ventricle dilated, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
fourth ventricle dilated, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
hindbrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
integument developmental pigmentation decreased process quality, abnormal	AB/TL + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
midbrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021
peripheral nervous system has fewer parts of type dorsal root ganglion, abnormal	sb2Tg + MO2-plxna1a	Figure 4 from Dworschak et al., 2021

Phenotype of all Fish created by or utilizing MO2-plxna1a

Phenotype	Fish	Conditions	Figures
brain development decreased process quality, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
eye developmental pigmentation decreased process quality, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
integument developmental pigmentation decreased process quality, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
brain decreased size, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
eye decreased diameter, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
camera-type eye development decreased process quality, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
brain hydrocephalic, abnormal	AB/TL + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
fourth ventricle dilated, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
forebrain ventricle dilated, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
hindbrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
midbrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
cerebellum hypoplastic, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
dorsal root ganglion development decreased process quality, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
peripheral nervous system has fewer parts of type dorsal root ganglion, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021
forebrain hypoplastic, abnormal	sb2Tg + MO2-plxna1a	standard conditions	Figure 4 from Dworschak et al., 2021

Citations