Morpholino

MO4-tcap

ID
ZDB-MRPHLNO-221118-2
Name
MO4-tcap
Previous Names
None
Target
Sequence
5' - CAGGACTGAGCAAACCTGCATCTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tcap
No data available
Phenotype
Phenotype resulting from MO4-tcap
Phenotype Fish Figures
axis curved ventral, abnormal AB + MO4-tcap FIGURE 2 with image,  FIGURE 5 with image from Lv et al., 2022
myoseptum structurally discontinuous, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
myoseptum U-shaped, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
post-vent region curved ventral, abnormal AB + MO4-tcap FIGURE 2 with image,  FIGURE 5 with image from Lv et al., 2022
skeletal muscle mitochondrial chromosome increased amount, abnormal AB + MO4-tcap FIGURE 3 with image,  FIGURE 6 with image from Lv et al., 2022
skeletal muscle cell mitochondrial crista morphology, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
skeletal muscle cell mitochondrial envelope morphology, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
somite muscle cell disorganized, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
somite muscle cell structure, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
whole organism dead, abnormal AB + MO4-tcap FIGURE 2 with image from Lv et al., 2022
whole organism Ab1-cs labeling decreased amount, abnormal AB + MO4-tcap FIGURE 4 with image,  FIGURE 6 with image from Lv et al., 2022
whole organism decreased length, abnormal AB + MO4-tcap FIGURE 5 with image from Lv et al., 2022
whole organism Ab2-lamp1 labeling increased amount, abnormal AB + MO4-tcap FIGURE 4 with image from Lv et al., 2022
whole organism Ab1-bnipl3 labeling increased amount, abnormal AB + MO4-tcap FIGURE 4 with image,  FIGURE 6 with image from Lv et al., 2022
whole organism Ab12-map1lc3 labeling increased amount, abnormal AB + MO4-tcap FIGURE 4 with image from Lv et al., 2022
whole organism cellular respiration decreased process quality, abnormal AB + MO4-tcap FIGURE 3 with image,  FIGURE 6 with image from Lv et al., 2022
whole organism reactive oxygen species increased amount, abnormal AB + MO4-tcap FIGURE 6 with image from Lv et al., 2022
whole organism swimming behavior decreased process quality, abnormal AB + MO4-tcap FIGURE 5 with image from Lv et al., 2022
Phenotype of all Fish created by or utilizing MO4-tcap
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO4-tcap control FIGURE 5 with image from Lv et al., 2022
whole organism Ab1-cs labeling amount, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 6 with image from Lv et al., 2022
whole organism reactive oxygen species amount, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 6 with image from Lv et al., 2022
skeletal muscle mitochondrial chromosome increased amount, abnormal AB + MO4-tcap control FIGURE 3 with image,  FIGURE 6 with image from Lv et al., 2022
skeletal muscle mitochondrial chromosome amount, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 6 with image from Lv et al., 2022
whole organism Ab1-bnipl3 labeling amount, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 6 with image from Lv et al., 2022
somite muscle cell disorganized, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
whole organism cellular respiration decreased process quality, abnormal AB + MO4-tcap control FIGURE 3 with image,  FIGURE 6 with image from Lv et al., 2022
skeletal muscle cell mitochondrial crista morphology, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
myoseptum U-shaped, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
whole organism Ab12-map1lc3 labeling increased amount, abnormal AB + MO4-tcap control FIGURE 4 with image from Lv et al., 2022
whole organism swimming behavior process quality, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 5 with image from Lv et al., 2022
whole organism Ab1-cs labeling decreased amount, abnormal AB + MO4-tcap control FIGURE 4 with image,  FIGURE 6 with image from Lv et al., 2022
post-vent region curved ventral, abnormal AB + MO4-tcap control FIGURE 2 with image,  FIGURE 5 with image from Lv et al., 2022
whole organism length, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 5 with image from Lv et al., 2022
axis curvature, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 5 with image from Lv et al., 2022
whole organism Ab1-bnipl3 labeling increased amount, abnormal AB + MO4-tcap control FIGURE 4 with image,  FIGURE 6 with image from Lv et al., 2022
skeletal muscle cell mitochondrial envelope morphology, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
whole organism swimming behavior decreased process quality, abnormal AB + MO4-tcap control FIGURE 5 with image from Lv et al., 2022
whole organism dead, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
axis curved ventral, abnormal AB + MO4-tcap control FIGURE 2 with image,  FIGURE 5 with image from Lv et al., 2022
myoseptum structurally discontinuous, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
post-vent region curvature, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 5 with image from Lv et al., 2022
somite muscle cell structure, abnormal AB + MO4-tcap control FIGURE 2 with image from Lv et al., 2022
whole organism reactive oxygen species increased amount, abnormal AB + MO4-tcap control FIGURE 6 with image from Lv et al., 2022
whole organism cellular respiration process quality, ameliorated AB + MO4-tcap chemical treatment by environment: idebenone FIGURE 6 with image from Lv et al., 2022
whole organism Ab2-lamp1 labeling increased amount, abnormal AB + MO4-tcap control FIGURE 4 with image from Lv et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.