Morpholino

MO1-ltbp1

ID
ZDB-MRPHLNO-221109-1
Name
MO1-ltbp1
Previous Names
None
Target
Sequence
5' - AAACAATGATGTCCCACACGAGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ltbp1
Expressed Gene Anatomy Figures
ckma Figure 5 with image from Xiong et al., 2020
sox9a Figure 5 with image from Xiong et al., 2020
Phenotype
Phenotype resulting from MO1-ltbp1
Phenotype Fish Figures
ceratobranchial cartilage absent, abnormal TU + MO1-ltbp1 Figure 2 with image from Xiong et al., 2020
cranial skeletal system development disrupted, abnormal TU + MO1-ltbp1 Figure 5 with image from Xiong et al., 2020
eye decreased size, abnormal TU + MO1-ltbp1 Figure 2 with image from Xiong et al., 2020
mandibular arch skeleton sox9a expression decreased amount, abnormal TU + MO1-ltbp1 Figure 5 with image from Xiong et al., 2020
mandibular arch skeleton malformed, abnormal TU + MO1-ltbp1 Figure 2 with image,  Figure 3 with image from Xiong et al., 2020
mandibular arch skeleton muscle ckma expression decreased amount, abnormal TU + MO1-ltbp1 Figure 5 with image from Xiong et al., 2020
Meckel's cartilage malformed, abnormal TU + MO1-ltbp1 Figure 2 with image from Xiong et al., 2020
pericardium edematous, abnormal TU + MO1-ltbp1 Figure 2 with image from Xiong et al., 2020
ventral mandibular arch decreased length, abnormal TU + MO1-ltbp1 Figure 3 with image from Xiong et al., 2020
ventral mandibular arch decreased width, abnormal TU + MO1-ltbp1 Figure 3 with image from Xiong et al., 2020
whole organism decreased length, abnormal TU + MO1-ltbp1 Figure 2 with image from Xiong et al., 2020
Phenotype of all Fish created by or utilizing MO1-ltbp1
Phenotype Fish Conditions Figures
cranial skeletal system development disrupted, abnormal TU + MO1-ltbp1 standard conditions Figure 5 with image from Xiong et al., 2020
mandibular arch skeleton sox9a expression decreased amount, abnormal TU + MO1-ltbp1 standard conditions Figure 5 with image from Xiong et al., 2020
eye decreased size, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image from Xiong et al., 2020
mandibular arch skeleton malformed, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image,  Figure 3 with image from Xiong et al., 2020
pericardium edematous, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image from Xiong et al., 2020
ceratobranchial cartilage absent, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image from Xiong et al., 2020
Meckel's cartilage malformed, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image from Xiong et al., 2020
ventral mandibular arch decreased length, abnormal TU + MO1-ltbp1 standard conditions Figure 3 with image from Xiong et al., 2020
mandibular arch skeleton muscle ckma expression decreased amount, abnormal TU + MO1-ltbp1 standard conditions Figure 5 with image from Xiong et al., 2020
whole organism decreased length, abnormal TU + MO1-ltbp1 standard conditions Figure 2 with image from Xiong et al., 2020
ventral mandibular arch decreased width, abnormal TU + MO1-ltbp1 standard conditions Figure 3 with image from Xiong et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.