Morpholino

MO1-sfxn1

ID
ZDB-MRPHLNO-211206-3
Name
MO1-sfxn1
Previous Names
None
Target
Sequence
5' - CACACTGTGGAGAGATTACACTGGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sfxn1
Expressed Gene Anatomy Figures
alas2 Fig. 4 from Bao et al., 2021
gata1a Fig. 2,  Fig. 3 from Bao et al., 2021
hbae1.1 Fig. 3 from Bao et al., 2021
hbae3 Fig. 2,  Fig. 3 from Bao et al., 2021
hbbe1.1 Fig. 2,  Fig. 3 from Bao et al., 2021
hbbe2 Fig. 3 from Bao et al., 2021
hbbe3 Fig. 3 from Bao et al., 2021
sfxn1 Fig. 1 from Bao et al., 2021
Phenotype
Phenotype resulting from MO1-sfxn1
Phenotype Fish Figures
nucleate erythrocyte hbbe1.1 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte hbbe3 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte hbae1.1 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte alas2 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 4 from Bao et al., 2021
nucleate erythrocyte hbbe2 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte hbae3 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte gata1a expression increased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte gata1a expression increased distribution, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
nucleate erythrocyte alas2 expression increased distribution, abnormal AB + MO1-sfxn1 Fig. 4 from Bao et al., 2021
nucleate erythrocyte hemoglobin decreased amount, abnormal AB + MO1-sfxn1 Fig. 2,  Fig. 4,  Fig. 5 from Bao et al., 2021
nucleate erythrocyte nucleus increased ratio nucleate erythrocyte cytoplasm, abnormal AB + MO1-sfxn1 Fig. 3,  Fig. 5 from Bao et al., 2021
whole organism hbae1.1 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
whole organism alas2 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 4 from Bao et al., 2021
whole organism hbae3 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
whole organism hbbe2 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
whole organism hbbe1.1 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
whole organism hbbe3 expression decreased amount, abnormal AB + MO1-sfxn1 Fig. 3 from Bao et al., 2021
Phenotype of all Fish created by or utilizing MO1-sfxn1
Phenotype Fish Conditions Figures
nucleate erythrocyte hbbe1.1 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
whole organism hbbe1.1 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
whole organism hbbe2 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
whole organism alas2 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 4 from Bao et al., 2021
nucleate erythrocyte hemoglobin amount, ameliorated AB + MO1-sfxn1 chemical treatment by environment: pyridoxine Fig. 5 from Bao et al., 2021
nucleate erythrocyte hbbe2 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte alas2 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 4 from Bao et al., 2021
nucleate erythrocyte hemoglobin decreased amount, abnormal AB + MO1-sfxn1 control Fig. 2,  Fig. 4,  Fig. 5 from Bao et al., 2021
whole organism hbbe3 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte nucleus increased ratio nucleate erythrocyte cytoplasm, abnormal AB + MO1-sfxn1 control Fig. 3,  Fig. 5 from Bao et al., 2021
nucleate erythrocyte hemoglobin amount, ameliorated AB + MO1-sfxn1 chemical treatment by environment: 5-aminolevulinate Fig. 5 from Bao et al., 2021
whole organism hbae3 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte hbae1.1 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte nucleus ratio nucleate erythrocyte cytoplasm, ameliorated AB + MO1-sfxn1 chemical treatment by environment: 5-aminolevulinate Fig. 5 from Bao et al., 2021
nucleate erythrocyte hbae3 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte hbbe3 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte gata1a expression increased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
whole organism hbae1.1 expression decreased amount, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte gata1a expression increased distribution, abnormal AB + MO1-sfxn1 control Fig. 3 from Bao et al., 2021
nucleate erythrocyte alas2 expression increased distribution, abnormal AB + MO1-sfxn1 control Fig. 4 from Bao et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.