Morpholino

MO4-hspg2

ID

ZDB-MRPHLNO-211110-1

Name

MO4-hspg2

Previous Names

None

Target

hspg2 (1)

Sequence

5' - TATCCTCGCCCCCATTTCTGCCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-hspg2

Expressed Gene	Anatomy	Figures
dlx2a	pharyngeal arch whole organism	Fig. 4 from Castellanos et al., 2021
nkx3-2	pharyngeal arch 1 pharyngeal arch 5 whole organism	Fig. 2 from Castellanos et al., 2021
sox10	whole organism	Fig. 5 , Fig. 6 from Castellanos et al., 2021

Phenotype

Phenotype resulting from MO4-hspg2

Phenotype	Fish	Figures
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal	AB + MO4-hspg2	Fig. 1 from Castellanos et al., 2021
chondrocyte EGFP expression decreased amount, abnormal	zf678Tg + MO4-hspg2	Fig. 7 from Castellanos et al., 2021
chondrocyte TagRFP expression decreased amount, abnormal	co26Tg + MO4-hspg2	Fig. 6 from Castellanos et al., 2021
chondrocyte TagRFP expression increased amount, abnormal	co26Tg + MO4-hspg2	Fig. 5 from Castellanos et al., 2021
cranial neural crest neural crest cell differentiation disrupted, abnormal	co26Tg + MO4-hspg2	Fig. 6 , Fig. 7 from Castellanos et al., 2021
Meckel's cartilage distance palatoquadrate arch, abnormal	AB + MO4-hspg2	Fig. 1 from Castellanos et al., 2021
pharyngeal arch 1 nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	Fig. 2 from Castellanos et al., 2021
pharyngeal arch 5 nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	Fig. 2 from Castellanos et al., 2021
quadrate-anguloarticular joint chondrocyte decreased amount, abnormal	zf678Tg + MO4-hspg2	Fig. 7 from Castellanos et al., 2021
ventral mandibular arch truncated, abnormal	AB + MO4-hspg2	Fig. 1 from Castellanos et al., 2021
whole organism nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	Fig. 2 from Castellanos et al., 2021
whole organism sox10 expression decreased amount, abnormal	co26Tg + MO4-hspg2	Fig. 6 from Castellanos et al., 2021
whole organism sox10 expression increased amount, abnormal	co26Tg + MO4-hspg2	Fig. 5 from Castellanos et al., 2021

Phenotype of all Fish created by or utilizing MO4-hspg2

Phenotype	Fish	Conditions	Figures
ventral mandibular arch truncated, abnormal	AB + MO4-hspg2	standard conditions	Fig. 1 from Castellanos et al., 2021
Meckel's cartilage distance palatoquadrate arch, abnormal	AB + MO4-hspg2	standard conditions	Fig. 1 from Castellanos et al., 2021
pharyngeal arch 1 nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	standard conditions	Fig. 2 from Castellanos et al., 2021
ceratohyal cartilage decreased distance Meckel's cartilage, abnormal	AB + MO4-hspg2	standard conditions	Fig. 1 from Castellanos et al., 2021
whole organism nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	standard conditions	Fig. 2 from Castellanos et al., 2021
pharyngeal arch 5 nkx3-2 expression decreased amount, abnormal	AB + MO4-hspg2	standard conditions	Fig. 2 from Castellanos et al., 2021
whole organism sox10 expression decreased amount, abnormal	co26Tg + MO4-hspg2	standard conditions	Fig. 6 from Castellanos et al., 2021
chondrocyte TagRFP expression increased amount, abnormal	co26Tg + MO4-hspg2	standard conditions	Fig. 5 from Castellanos et al., 2021
cranial neural crest neural crest cell differentiation disrupted, abnormal	co26Tg + MO4-hspg2	standard conditions	Fig. 6 from Castellanos et al., 2021
chondrocyte TagRFP expression decreased amount, abnormal	co26Tg + MO4-hspg2	standard conditions	Fig. 6 from Castellanos et al., 2021
whole organism sox10 expression increased amount, abnormal	co26Tg + MO4-hspg2	standard conditions	Fig. 5 from Castellanos et al., 2021
cranial neural crest neural crest cell differentiation disrupted, abnormal	zf678Tg + MO4-hspg2	standard conditions	Fig. 7 from Castellanos et al., 2021
quadrate-anguloarticular joint chondrocyte decreased amount, abnormal	zf678Tg + MO4-hspg2	standard conditions	Fig. 7 from Castellanos et al., 2021
chondrocyte EGFP expression decreased amount, abnormal	zf678Tg + MO4-hspg2	standard conditions	Fig. 7 from Castellanos et al., 2021

Citations