Morpholino

MO2-hecw2a

ID

ZDB-MRPHLNO-211028-2

Name

MO2-hecw2a

Previous Names

None

Target

Sequence

5' - GTTTTGTGTCATGCTTACCCTGTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hecw2a

No data available

Phenotype

Phenotype resulting from MO2-hecw2a

Phenotype	Fish	Figures
brain opaque, abnormal	AB + MO2-hecw2a	Fig. 2 from Lu et al., 2020
cranial motor neuron determination of bilateral symmetry disrupted, abnormal	rw0Tg + MO2-hecw2a	Fig. 2 from Lu et al., 2020
eye opaque, abnormal	AB + MO2-hecw2a	Fig. 2 from Lu et al., 2020
pericardium edematous, abnormal	AB + MO2-hecw2a	text only from Lu et al., 2020
post-vent region curved, abnormal	AB + MO2-hecw2a	Fig. 2, text only from Lu et al., 2020
post-vent region decreased length, abnormal	AB + MO2-hecw2a	Fig. 2 from Lu et al., 2020
spinal cord opaque, abnormal	AB + MO2-hecw2a	Fig. 2 from Lu et al., 2020
spinal cord motor neuron disorganized, abnormal	rw0Tg + MO2-hecw2a	Fig. 2 from Lu et al., 2020
whole organism dead, abnormal	AB + MO2-hecw2a	text only from Lu et al., 2020
whole organism deformed, abnormal	AB + MO2-hecw2a	Fig. 2 from Lu et al., 2020

Phenotype of all Fish created by or utilizing MO2-hecw2a

Phenotype	Fish	Conditions	Figures
post-vent region curved, abnormal	AB + MO2-hecw2a	control	Fig. 2, text only from Lu et al., 2020
whole organism dead, abnormal	AB + MO2-hecw2a	control	text only from Lu et al., 2020
spinal cord opaque, abnormal	AB + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
post-vent region decreased length, abnormal	AB + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
eye opaque, abnormal	AB + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
brain opaque, abnormal	AB + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
pericardium edematous, abnormal	AB + MO2-hecw2a	control	text only from Lu et al., 2020
whole organism deformed, abnormal	AB + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
spinal cord motor neuron disorganized, abnormal	rw0Tg + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020
cranial motor neuron determination of bilateral symmetry disrupted, abnormal	rw0Tg + MO2-hecw2a	control	Fig. 2 from Lu et al., 2020

Citations