Morpholino

MO1-rrm2b

ID

ZDB-MRPHLNO-210706-1

Name

MO1-rrm2b

Previous Names

e4i4 (1)

Target

rrm2b (1)

Sequence

5' - TTTCATGTTCATCTCACCTCTCTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rrm2b

No data available

Phenotype

Phenotype resulting from MO1-rrm2b

Phenotype	Fish	Figures
embryo development disrupted, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020
head morphology, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020
post-vent region morphology, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020
post-vent region apoptotic process increased occurrence, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020
whole organism dead, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020
whole organism decreased life span, abnormal	AB + MO1-rrm2b	FIGURE 1 from Tseng et al., 2020

Phenotype of all Fish created by or utilizing MO1-rrm2b

Phenotype	Fish	Conditions	Figures
post-vent region apoptotic process increased occurrence, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020
whole organism mitochondrial chromosome decreased amount, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
whole organism decreased life span, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020
mitochondrial genome maintenance process quality, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
whole organism mt-nd1 expression decreased amount, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
whole organism mt-nd5 expression decreased amount, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
whole organism gstp1.2 expression decreased amount, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
head morphology, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020
whole organism gclc expression decreased amount, abnormal	AB + MO1-rrm2b	chemical treatment by environment: hydrogen peroxide	Fig. 3 from Tseng et al., 2020
post-vent region morphology, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020
embryo development disrupted, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020
whole organism dead, abnormal	AB + MO1-rrm2b	standard conditions	FIGURE 1 from Tseng et al., 2020

Citations