Morpholino
MO2-col11a1a
- ID
- ZDB-MRPHLNO-210412-3
- Name
- MO2-col11a1a
- Previous Names
- None
- Target
- Sequence
-
5' - GTTGTGTACTGCACATAGGGAGAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-col11a1a
No data available
Phenotype
Phenotype resulting from MO2-col11a1a
Phenotype of all Fish created by or utilizing MO2-col11a1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| otolith decreased amount, abnormal | AB + MO2-col11a1a | control |
Table 4
from Hardy et al., 2020 |
| whole organism decreased length, abnormal | AB + MO2-col11a1a | control |
Table 3
from Hardy et al., 2020 |
| otolith absent, abnormal | AB + MO2-col11a1a | control |
Fig. 7
from Hardy et al., 2020 |
| otolith increased amount, abnormal | AB + MO2-col11a1a | control |
Table 4
from Hardy et al., 2020 |
| Meckel's cartilage decreased size, abnormal | AB + MO2-col11a1a | control |
Fig. 7,
Table 4
from Hardy et al., 2020 |
| pericardium edematous, abnormal | AB + MO2-col11a1a | control |
Table 4
from Hardy et al., 2020 |
Citations