Morpholino

MO1-col11a1a

ID

ZDB-MRPHLNO-210412-1

Name

MO1-col11a1a

Previous Names

None

Target

col11a1a (1)

Sequence

5' - GGGACCACCTTGGCCTCTCCATGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-col11a1a

No data available

Phenotype

Phenotype resulting from MO1-col11a1a

Phenotype	Fish	Figures
cranial cartilage disorganized, abnormal	AB + MO1-col11a1a	Fig. 7 from Hardy et al., 2020
mandibular arch skeleton decreased size, abnormal	AB + MO1-col11a1a	Figure 1 from Reeck et al., 2022
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal	y1Tg + MO1-col11a1a	Figure 2 from Reeck et al., 2022
Meckel's cartilage decreased size, abnormal	AB + MO1-col11a1a	Table 4 from Hardy et al., 2020
Meckel's cartilage chondrocyte organization quality, abnormal	y1Tg + MO1-col11a1a	Figure 3 from Reeck et al., 2022
Meckel's cartilage osteoblast disorganized, abnormal	b1212Tg + MO1-col11a1a	Figure 4 from Reeck et al., 2022
otolith decreased amount, abnormal	AB + MO1-col11a1a	Table 4 from Hardy et al., 2020
otolith increased amount, abnormal	AB + MO1-col11a1a	Table 4 from Hardy et al., 2020
palatoquadrate cartilage increased distance Meckel's cartilage, abnormal	y1Tg + MO1-col11a1a	Figure 2 from Reeck et al., 2022
pericardium edematous, abnormal	AB + MO1-col11a1a	Fig. 5, Table 4 from Hardy et al., 2020
perichondrium bone mineralization disrupted, abnormal	y1Tg + MO1-col11a1a	Figure 3 , Figure 4 from Reeck et al., 2022
pharyngeal arch cartilage morphology, abnormal	y1Tg + MO1-col11a1a	Figure 1 , Figure 2 from Reeck et al., 2022
post-vent region curved, abnormal	AB + MO1-col11a1a	Fig. 5 from Hardy et al., 2020
ventral mandibular arch shortened, abnormal	AB + MO1-col11a1a	Fig. 7 from Hardy et al., 2020
whole organism decreased length, abnormal	AB + MO1-col11a1a	Fig. 5, Table 3 from Hardy et al., 2020
whole organism anterior-posterior axis curved, abnormal	AB + MO1-col11a1a	Figure 1 from Reeck et al., 2022

Phenotype of all Fish created by or utilizing MO1-col11a1a

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	AB + MO1-col11a1a	control	Fig. 5, Table 3 from Hardy et al., 2020
cranial cartilage disorganized, abnormal	AB + MO1-col11a1a	control	Fig. 7 from Hardy et al., 2020
otolith increased amount, abnormal	AB + MO1-col11a1a	control	Table 4 from Hardy et al., 2020
Meckel's cartilage decreased size, abnormal	AB + MO1-col11a1a	control	Table 4 from Hardy et al., 2020
mandibular arch skeleton decreased size, abnormal	AB + MO1-col11a1a	standard conditions	Figure 1 from Reeck et al., 2022
ventral mandibular arch shortened, abnormal	AB + MO1-col11a1a	control	Fig. 7 from Hardy et al., 2020
post-vent region curved, abnormal	AB + MO1-col11a1a	control	Fig. 5 from Hardy et al., 2020
otolith decreased amount, abnormal	AB + MO1-col11a1a	control	Table 4 from Hardy et al., 2020
whole organism anterior-posterior axis curved, abnormal	AB + MO1-col11a1a	standard conditions	Figure 1 from Reeck et al., 2022
pericardium edematous, abnormal	AB + MO1-col11a1a	control	Fig. 5, Table 4 from Hardy et al., 2020
pharyngeal arch cartilage morphology, abnormal	AB + MO1-col11a1a	standard conditions	Figure 1 from Reeck et al., 2022
perichondrium bone mineralization disrupted, abnormal	b1212Tg + MO1-col11a1a	standard conditions	Figure 4 from Reeck et al., 2022
Meckel's cartilage osteoblast disorganized, abnormal	b1212Tg + MO1-col11a1a	standard conditions	Figure 4 from Reeck et al., 2022
perichondrium bone mineralization disrupted, abnormal	y1Tg + MO1-col11a1a	standard conditions	Figure 3 from Reeck et al., 2022
palatoquadrate cartilage increased distance Meckel's cartilage, abnormal	y1Tg + MO1-col11a1a	standard conditions	Figure 2 from Reeck et al., 2022
Meckel's cartilage chondrocyte organization quality, abnormal	y1Tg + MO1-col11a1a	standard conditions	Figure 3 from Reeck et al., 2022
pharyngeal arch cartilage morphology, abnormal	y1Tg + MO1-col11a1a	standard conditions	Figure 2 from Reeck et al., 2022
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal	y1Tg + MO1-col11a1a	standard conditions	Figure 2 from Reeck et al., 2022

Citations