Morpholino

MO1-cgasb

ID
ZDB-MRPHLNO-210312-1
Name
MO1-cgasb
Previous Names
None
Target
Sequence
5' - GTTCTTGTTCGACTTTCCATGATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cgasb
No data available
Phenotype
Phenotype resulting from MO1-cgasb
No data available
Phenotype of all Fish created by or utilizing MO1-cgasb
Phenotype Fish Conditions Figures
head kidney il1b expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism hamp expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, abnormal WT + MO1-cgasb viral treatment by exposure to environment: Rhabdoviridae Fig. 9 from Liu et al., 2020
whole organism dead, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism il1b expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney irf3 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi1 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi1 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism dead, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Edwardsiella tarda Fig. 9 from Liu et al., 2020
whole organism irf3 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney il6 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism ifnphi3 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney hamp expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
whole organism il6 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
head kidney ifnphi3 expression increased amount, abnormal WT + MO1-cgasb bacterial treatment by exposure to environment: Aeromonas hydrophila Fig. 9 from Liu et al., 2020
Citations