Morpholino
MO1-b4galt7
- ID
- ZDB-MRPHLNO-210111-2
- Name
- MO1-b4galt7
- Previous Names
- None
- Target
- Sequence
-
5' - TGCACTTTAGGCAGAAATCACAAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-b4galt7
Expressed Gene | Anatomy | Figures |
---|---|---|
b4galt7 |
Fig. 2
from Delbaere et al., 2019 |
Phenotype
Phenotype resulting from MO1-b4galt7
Phenotype of all Fish created by or utilizing MO1-b4galt7
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
whole organism b4galt7 expression decreased amount, abnormal | AB + MO1-b4galt7 | standard conditions |
Fig. 2
from Delbaere et al., 2019 |
head decreased length, abnormal | AB + MO1-b4galt7 | control |
Fig. 3
from Delbaere et al., 2019 |
pectoral fin deformed, abnormal | AB + MO1-b4galt7 | control |
Fig. 3
from Delbaere et al., 2019 |
whole organism decreased length, abnormal | AB + MO1-b4galt7 | control |
Fig. 3
from Delbaere et al., 2019 |
pharyngeal arch decreased size, abnormal | AB + MO1-b4galt7 | control |
Fig. 3
from Delbaere et al., 2019 |
Citations