Morpholino

MO1-kif14

ID

ZDB-MRPHLNO-201201-1

Name

MO1-kif14

Previous Names

None

Target

Sequence

5' - CTCCATGAGGTGTGCTGGAGCTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kif14

No data available

Phenotype

Phenotype resulting from MO1-kif14

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
head decreased size, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
heart edematous, abnormal	WT + MO1-kif14 + MO4-tp53	Fig. S5 from Reilly et al., 2018
otolith amount, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
otolith fused with otolith, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
otolith mislocalised, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
otolith size, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
pronephric tubule dilated, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018
whole organism increased curvature, abnormal	WT + MO1-kif14 + MO4-tp53	Fig. S5 from Reilly et al., 2018
whole organism viability, abnormal	WT + MO1-kif14	Fig. S5 from Reilly et al., 2018

Phenotype of all Fish created by or utilizing MO1-kif14

Phenotype	Fish	Conditions	Figures
pronephric tubule dilated, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
otolith mislocalised, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
otolith amount, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
heart edematous, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
head decreased size, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
otolith fused with otolith, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
whole organism viability, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
whole organism increased curvature, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
otolith size, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
brain hydrocephalic, abnormal	WT + MO1-kif14	standard conditions	Fig. S5 from Reilly et al., 2018
heart edematous, abnormal	WT + MO1-kif14 + MO4-tp53	standard conditions	Fig. S5 from Reilly et al., 2018
whole organism increased curvature, abnormal	WT + MO1-kif14 + MO4-tp53	standard conditions	Fig. S5 from Reilly et al., 2018

Citations