Morpholino

MO1-arl4aa

ID
ZDB-MRPHLNO-201015-1
Name
MO1-arl4aa
Previous Names
None
Target
Sequence
5' - TATCCCGTTCCCCATTTCCTTCAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl4aa
Expressed Gene Anatomy Figures
gata2a Fig. 6 with image from Guo et al., 2020
gata2b Fig. 6 with image from Guo et al., 2020
her5 Fig. 6 with image from Guo et al., 2020
hey2 Fig. 6 with image from Guo et al., 2020
myb Fig. 2 with image,  Fig. 6 with image from Guo et al., 2020
notch1a Fig. 6 with image from Guo et al., 2020
notch3 Fig. 6 with image from Guo et al., 2020
rag1 Fig. 2 with image from Guo et al., 2020
runx1 Fig. 2 with image from Guo et al., 2020
Phenotype
Phenotype resulting from MO1-arl4aa
Phenotype Fish Figures
caudal hematopoietic tissue myb expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
dorsal aorta myb expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
thymus rag1 expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
trunk vasculature EGFP expression decreased distribution, abnormal ci5Tg; um14Tg + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca4Tg + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta perinuclear region of cytoplasm AB2-glogb1 labeling spatial pattern, abnormal ci5Tg + MO1-arl4aa Fig. 5 with image from Guo et al., 2020
whole organism her5 expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism gata2b expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism gata2a expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism notch1a expression increased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism notch3 expression increased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
Phenotype of all Fish created by or utilizing MO1-arl4aa
Phenotype Fish Conditions Figures
caudal hematopoietic tissue myb expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism gata2b expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism her5 expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
whole organism notch1a expression increased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
thymus rag1 expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism notch3 expression increased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
whole organism gata2a expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
dorsal aorta myb expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta perinuclear region of cytoplasm AB2-glogb1 labeling spatial pattern, abnormal ci5Tg + MO1-arl4aa standard conditions Fig. 5 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca4Tg + MO1-arl4aa heat shock Fig. 6 with image from Guo et al., 2020
trunk vasculature EGFP expression decreased distribution, abnormal ci5Tg; um14Tg + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-arl4aa heat shock Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca3Tg; kca4Tg + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.