Morpholino

MO1-cspg4

ID

ZDB-MRPHLNO-201001-1

Name

MO1-cspg4

Previous Names

MO-e2i2 (1)

Target

cspg4 (1)

Sequence

5' - GATGCTGCAAACACAGAGCAGAGAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cspg4

Expressed Gene	Anatomy	Figures
myod1	paraxial mesoderm	Fig 8 from Lee et al., 2020
tbxta	notochord	Fig 8 from Lee et al., 2020

Phenotype

Phenotype resulting from MO1-cspg4

Phenotype	Fish	Figures
axis elongation process quality, abnormal	AB + MO1-cspg4	Fig 5 , Fig 7 from Lee et al., 2020
ceratohyal cartilage decreased length, abnormal	AB + MO1-cspg4	Fig 4 from Lee et al., 2020
ceratohyal cartilage hypoplastic, abnormal	AB + MO1-cspg4	Fig 4 from Lee et al., 2020
Meckel's cartilage hypoplastic, abnormal	AB + MO1-cspg4	Fig 4 from Lee et al., 2020
notochord tbxta expression spatial pattern, abnormal	AB + MO1-cspg4	Fig 8 from Lee et al., 2020
paraxial mesoderm myod1 expression spatial pattern, abnormal	AB + MO1-cspg4	Fig 8 from Lee et al., 2020
pharyngeal arch cartilage deformed, abnormal	AB + MO1-cspg4	Fig 4 from Lee et al., 2020
whole organism decreased length, abnormal	AB + MO1-cspg4	Fig 3 from Lee et al., 2020
whole organism anterior-posterior axis decreased length, abnormal	AB + MO1-cspg4	Fig 5 , Fig 7 from Lee et al., 2020

Phenotype of all Fish created by or utilizing MO1-cspg4

Phenotype	Fish	Conditions	Figures
ceratohyal cartilage decreased length, abnormal	AB + MO1-cspg4	standard conditions	Fig 4 from Lee et al., 2020
notochord tbxta expression spatial pattern, abnormal	AB + MO1-cspg4	standard conditions	Fig 8 from Lee et al., 2020
whole organism anterior-posterior axis decreased length, abnormal	AB + MO1-cspg4	standard conditions	Fig 5 , Fig 7 from Lee et al., 2020
whole organism decreased length, abnormal	AB + MO1-cspg4	standard conditions	Fig 3 from Lee et al., 2020
pharyngeal arch cartilage deformed, abnormal	AB + MO1-cspg4	standard conditions	Fig 4 from Lee et al., 2020
Meckel's cartilage hypoplastic, abnormal	AB + MO1-cspg4	standard conditions	Fig 4 from Lee et al., 2020
ceratohyal cartilage hypoplastic, abnormal	AB + MO1-cspg4	standard conditions	Fig 4 from Lee et al., 2020
axis elongation process quality, abnormal	AB + MO1-cspg4	standard conditions	Fig 5 , Fig 7 from Lee et al., 2020
paraxial mesoderm myod1 expression spatial pattern, abnormal	AB + MO1-cspg4	standard conditions	Fig 8 from Lee et al., 2020
eye fused with eye, abnormal	AB + MO1-cspg4 + MO2-cspg4	standard conditions	Fig 6 from Lee et al., 2020
whole organism anterior-posterior axis decreased length, abnormal	AB + MO1-cspg4 + MO2-cspg4	standard conditions	Fig 5 from Lee et al., 2020
notochord bifurcated, abnormal	AB + MO1-cspg4 + MO2-cspg4	standard conditions	Fig 6 from Lee et al., 2020
axis elongation process quality, abnormal	AB + MO1-cspg4 + MO2-cspg4	standard conditions	Fig 5 from Lee et al., 2020
axis split, abnormal	AB + MO1-cspg4 + MO2-cspg4	standard conditions	Fig 6 from Lee et al., 2020

Citations