Morpholino

MO1-reep5

ID

ZDB-MRPHLNO-200729-1

Name

MO1-reep5

Previous Names

None

Target

reep5 (1)

Sequence

5' - GCCGCCATGATTTGTCTGAAGGGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-reep5

No data available

Phenotype

Phenotype resulting from MO1-reep5

Phenotype	Fish	Figures
atrium swollen, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
cardiac muscle cell myofibril disorganized, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
cardiac muscle cell sarcomere structurally discontinuous, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
cardiac muscle cell sarcoplasmic reticulum membrane vacuolated, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
cardiac ventricle swollen, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
heart linear, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
heart morphology, abnormal	WT + MO1-reep5	Fig. 8 , Fig. S6 from Lee et al., 2020
heart contraction irregular rhythm, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
heart looping arrested, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
heart looping disrupted, abnormal	twu34Tg + MO1-reep5	Fig. S6 from Lee et al., 2020
pericardium edematous, abnormal	WT + MO1-reep5	Fig. 8 , Fig. S6 from Lee et al., 2020
whole organism Ab1-reep5 labeling decreased amount, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
whole organism decreased life span, abnormal	WT + MO1-reep5	text only from Lee et al., 2020
whole organism Ab1-atl3 labeling increased amount, abnormal	WT + MO1-reep5	Fig. S6 from Lee et al., 2020
whole organism viability, abnormal	WT + MO1-reep5	text only from Lee et al., 2020

Phenotype of all Fish created by or utilizing MO1-reep5

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO1-reep5	standard conditions	Fig. 8 , Fig. S6 from Lee et al., 2020
atrium swollen, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
whole organism Ab1-atl3 labeling increased amount, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
whole organism decreased life span, abnormal	WT + MO1-reep5	standard conditions	text only from Lee et al., 2020
heart contraction irregular rhythm, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
cardiac ventricle swollen, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
whole organism viability, abnormal	WT + MO1-reep5	standard conditions	text only from Lee et al., 2020
heart morphology, abnormal	WT + MO1-reep5	standard conditions	Fig. 8 from Lee et al., 2020
heart linear, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
cardiac muscle cell sarcomere structurally discontinuous, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
whole organism Ab1-reep5 labeling decreased amount, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
heart looping arrested, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
heart looping disrupted, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
cardiac muscle cell myofibril disorganized, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
cardiac muscle cell sarcoplasmic reticulum membrane vacuolated, abnormal	WT + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
heart looping disrupted, abnormal	twu34Tg + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020
heart morphology, abnormal	twu34Tg + MO1-reep5	standard conditions	Fig. S6 from Lee et al., 2020

Citations