Morpholino

MO1-bach2a

ID

ZDB-MRPHLNO-200630-1

Name

MO1-bach2a

Previous Names

None

Target

Sequence

5' - TGTCAGGCTTCTCCTCCATAGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bach2a

Expressed Gene	Anatomy	Figures
vegfc	dorsal aorta	Fig. 7 from Cohen et al., 2020

Phenotype

Phenotype resulting from MO1-bach2a

Phenotype	Fish	Figures
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	y1Tg + MO1-bach2a	Fig. 2 , Fig. 7 from Cohen et al., 2020
dorsal aorta vegfc expression decreased amount, abnormal	AB/EKW + MO1-bach2a	Fig. 7 from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal	y1Tg + MO1-bach2a	Fig. 2 , Fig. 7 from Cohen et al., 2020
thoracic duct lymphangiogenesis decreased process quality, abnormal	y1Tg + MO1-bach2a	Fig. 4 , Fig. 7 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	y1Tg + MO1-bach2a	Fig. 3 , Fig. 7 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	y1Tg + MO1-bach2a	Fig. 4 , Fig. 7 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	y1Tg + MO1-bach2a	Fig. 3 , Fig. 7 from Cohen et al., 2020

Phenotype of all Fish created by or utilizing MO1-bach2a

Phenotype	Fish	Conditions	Figures
dorsal aorta vegfc expression decreased amount, abnormal	AB/EKW + MO1-bach2a	standard conditions	Fig. 7 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 4 , Fig. 7 from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 2 , Fig. 7 from Cohen et al., 2020
thoracic duct lymphangiogenesis decreased process quality, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 4 , Fig. 7 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 3 , Fig. 7 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 3 , Fig. 7 from Cohen et al., 2020
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	y1Tg + MO1-bach2a	standard conditions	Fig. 2 , Fig. 7 from Cohen et al., 2020

Citations