Morpholino

MO1-hps1

ID

ZDB-MRPHLNO-200504-1

Name

MO1-hps1

Previous Names

Target

Sequence

5' - AGTGTCATTGTTTCTGAATCCTGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hps1

No data available

Phenotype

Phenotype resulting from MO1-hps1

Phenotype	Fish	Figures
ocular blood vessel increased permeability, abnormal	lri500Tg + MO1-hps1	Fig. 4 from Schenk et al., 2019
pericardium edematous, abnormal	WT + MO1-hps1	Fig. 4 from Schenk et al., 2019
post-vent region increased curvature, abnormal	WT + MO1-hps1	Fig. 4 from Schenk et al., 2019
pronephric glomerulus damaged, abnormal	lri500Tg + MO1-hps1	Fig. 5 from Schenk et al., 2019
pronephric glomerulus glomerular endothelium fenestra decreased amount, abnormal	lri500Tg + MO1-hps1	Fig. 5 from Schenk et al., 2019
pronephric podocyte composition, abnormal	lri500Tg + MO1-hps1	Fig. 5 from Schenk et al., 2019
pronephric podocyte has extra parts of type pronephric podocyte inclusion body, abnormal	lri500Tg + MO1-hps1	Fig. 5 from Schenk et al., 2019
pronephric podocyte podocyte foot morphology, abnormal	lri500Tg + MO1-hps1	Fig. 5 from Schenk et al., 2019
whole organism decreased life span, abnormal	WT + MO1-hps1	Fig. 4 from Schenk et al., 2019
yolk edematous, abnormal	WT + MO1-hps1	Fig. 4 from Schenk et al., 2019

Phenotype of all Fish created by or utilizing MO1-hps1

Phenotype	Fish	Conditions	Figures
whole organism decreased life span, abnormal	WT + MO1-hps1	standard conditions	Fig. 4 from Schenk et al., 2019
post-vent region increased curvature, abnormal	WT + MO1-hps1	standard conditions	Fig. 4 from Schenk et al., 2019
pericardium edematous, abnormal	WT + MO1-hps1	standard conditions	Fig. 4 from Schenk et al., 2019
yolk edematous, abnormal	WT + MO1-hps1	standard conditions	Fig. 4 from Schenk et al., 2019
pronephric glomerulus glomerular endothelium fenestra decreased amount, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 5 from Schenk et al., 2019
pronephric podocyte has extra parts of type pronephric podocyte inclusion body, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 5 from Schenk et al., 2019
ocular blood vessel increased permeability, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 4 from Schenk et al., 2019
pronephric podocyte composition, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 5 from Schenk et al., 2019
pronephric podocyte podocyte foot morphology, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 5 from Schenk et al., 2019
pronephric glomerulus damaged, abnormal	lri500Tg + MO1-hps1	standard conditions	Fig. 5 from Schenk et al., 2019

Citations