Morpholino

MO2-hdac8

ID

ZDB-MRPHLNO-200304-2

Name

MO2-hdac8

Previous Names

None

Target

Sequence

5' - CATTACTGTCGCTTTTTTCACTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-hdac8

Expressed Gene	Anatomy	Figures
hdac8	whole organism	Fig. 6 from Bottai et al., 2018

Phenotype

Phenotype resulting from MO2-hdac8

Phenotype	Fish	Figures
central nervous system structure, abnormal	AB + MO2-hdac8	Fig. 6 from Bottai et al., 2018
central nervous system apoptotic process increased process quality, abnormal	AB + MO2-hdac8	Fig. 8 from Bottai et al., 2018
eye size, abnormal	AB + MO2-hdac8	Fig. 6 from Bottai et al., 2018
head structure, abnormal	AB + MO2-hdac8	Fig. 6 from Bottai et al., 2018
post-vent region curved, abnormal	AB + MO2-hdac8	Fig. 6 from Bottai et al., 2018
skeletal muscle morphology, abnormal	AB + MO2-hdac8	Fig. S2 from Ferrari et al., 2018
skeletal muscle myosin complex decreased amount, abnormal	AB + MO2-hdac8	Fig. S2 from Ferrari et al., 2018
whole organism hdac8 expression decreased amount, abnormal	AB + MO2-hdac8	Fig. 6 from Bottai et al., 2018

Phenotype of all Fish created by or utilizing MO2-hdac8

Phenotype	Fish	Conditions	Figures
skeletal muscle morphology, abnormal	AB + MO2-hdac8	control	Fig. S2 from Ferrari et al., 2018
head structure, abnormal	AB + MO2-hdac8	standard conditions	Fig. 6 from Bottai et al., 2018
skeletal muscle myosin complex decreased amount, abnormal	AB + MO2-hdac8	control	Fig. S2 from Ferrari et al., 2018
eye size, abnormal	AB + MO2-hdac8	standard conditions	Fig. 6 from Bottai et al., 2018
post-vent region curved, abnormal	AB + MO2-hdac8	standard conditions	Fig. 6 from Bottai et al., 2018
whole organism hdac8 expression decreased amount, abnormal	AB + MO2-hdac8	standard conditions	Fig. 6 from Bottai et al., 2018
central nervous system structure, abnormal	AB + MO2-hdac8	standard conditions	Fig. 6 from Bottai et al., 2018
central nervous system apoptotic process increased process quality, abnormal	AB + MO2-hdac8	standard conditions	Fig. 8 from Bottai et al., 2018
central nervous system apoptotic process increased process quality, abnormal	AB + MO2-hdac8 + MO3-hdac8	standard conditions	Fig. 8 from Bottai et al., 2018
central nervous system apoptotic process process quality, ameliorated	AB + MO2-hdac8 + MO3-hdac8	chemical treatment by environment: lithium chloride	Fig. 7 from Bottai et al., 2018

Citations